or
or
Exact

Results for "RELN"

Variant Events: 173

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RELN     Gecz1_26653chr7:
103113284-103113284
CTexonicUnknownnonsynonymous SNVNM_173054
NM_005045
c.G10352A
c.G10358A
p.R3451Q
p.R3453Q
23.03.302E-5Wang2020 T
RELN     ITAN_1408chr7:
103292197-103292197
CAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G1803T
c.G1803T
p.W601C
p.W601C
24.78.34E-6Wang2020 T
RELN     ACGC_M23847chr7:
103185783-103185783
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6311A
c.G6311A
p.R2104H
p.R2104H
33.07.528E-5Wang2020 T
RELN     09C81884chr7:
103155785-103155785
CTexonicDe novononsynonymous SNVNM_005045
NM_173054
c.G7966A
c.G7966A
p.D2656N
p.D2656N
34.0-Stessman2017 T
Stessman2017 T
RELN     AU4219302chr7:
103530749-103530749
CTintronicDe novo--Trost2022 G
Yuen2017 G
RELN     AGRE_AU1501301chr7:
103113284-103113284
CTexonicUnknownnonsynonymous SNVNM_173054
NM_005045
c.G10352A
c.G10358A
p.R3451Q
p.R3453Q
23.03.302E-5Wang2020 T
RELN     5-0114-003chr7:
103406247-103406247
ACintronicDe novo--Trost2022 G
Yuen2017 G
RELN     ITAN_625chr7:
103113284-103113284
CTexonicMaternalnonsynonymous SNVNM_173054
NM_005045
c.G10352A
c.G10358A
p.R3451Q
p.R3453Q
23.03.302E-5Wang2020 T
RELN     M21714chr7:
103205755-103205755
CTexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.G5180A
c.G5180A
p.R1727Q
p.R1727Q
33.03.296E-5Guo2018 T
Wang2016 T
RELN     Stessman2017:ASD_1304chr7:
103180649-103180649
CTexonicInheritednonsynonymous SNVNM_005045
NM_173054
c.G6925A
c.G6925A
p.D2309N
p.D2309N
31.04.131E-5Stessman2017 T
RELN     M19617chr7:
103474032-103474032
CTexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.G425A
c.G425A
p.S142N
p.S142N
34.03.299E-5Guo2018 T
Wang2016 T
RELN     ITAN_2258chr7:
103216138-103216138
CTexonicMaternalnonsynonymous SNVNM_005045
NM_173054
c.G4160A
c.G4160A
p.R1387Q
p.R1387Q
35.0-Wang2020 T
RELN     13177.p1chr7:
103126691-103126691
ACexonicDe novononsynonymous SNVNM_005045
NM_173054
c.T9936G
c.T9936G
p.C3312W
p.C3312W
18.231.0E-4Satterstrom2020 E
RELN     SF0028290.p1chr7:
103251161-103251161
GCexonicnonsynonymous SNVNM_005045
NM_173054
c.C2989G
c.C2989G
p.L997V
p.L997V
8.8480.1166Wang2020 T
RELN     1-0465-003achr7:
103269669-103269669
CGintronicDe novo--Yuen2017 G
RELN     SF0014554.p1chr7:
103130333-103130333
GAexonicnonsynonymous SNVNM_005045
NM_173054
c.C9619T
c.C9619T
p.R3207C
p.R3207C
23.8-Wang2020 T
RELN     AU4264302chr7:
103175155-103175155
CGintronicDe novo--Trost2022 G
Yuen2017 G
RELN     2-1428-003chr7:
103177893-103177893
GAintronicDe novo--Trost2022 G
Yuen2017 G
RELN     14093.p1chr7:
103718420-103718420
CTintergenicDe novo--Wilfert2021 G
RELN     AU3907302chr7:
103440504-103440504
TAintronicDe novo--Trost2022 G
Yuen2017 G
RELN     AGRE_04C29909chr7:
103151311-103151311
ACexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.T8261G
c.T8261G
p.I2754S
p.I2754S
21.91.663E-5Wang2020 T
RELN     SF0087907.p1chr7:
103474061-103474061
GTexonicnonsynonymous SNVNM_005045
NM_173054
c.C396A
c.C396A
p.H132Q
p.H132Q
18.478.277E-6Wang2020 T
RELN     Li2017:17444chr7:
103237104-103237104
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G3338A
c.G3338A
p.G1113E
p.G1113E
27.28.279E-6Li2017 T
RELN     GX0320.p1chr7:
103393662-103393662
CAsplicingMaternalsplicing13.81-Guo2018 T
RELN     7-0002-003chr7:
103696620-103696620
GAintergenicDe novo--Yuen2017 G
RELN     SAGE_BK830-02chr7:
103136210-103136210
CTexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.G9329A
c.G9329A
p.R3110Q
p.R3110Q
35.08.24E-5Wang2020 T
RELN     Li2017:17563chr7:
103143548-103143548
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G8404A
c.G8404A
p.G2802R
p.G2802R
28.41.648E-5Li2017 T
RELN     ACGC_M30612chr7:
103243834-103243835
GCGexonicPaternalframeshift deletionNM_005045
NM_173054
c.3249delG
c.3249delG
p.W1083fs
p.W1083fs
--Wang2020 T
RELN     ACGC_M21714chr7:
103205755-103205755
CTexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.G5180A
c.G5180A
p.R1727Q
p.R1727Q
33.03.296E-5Wang2020 T
RELN     AU0531302chr7:
103207069-103207069
GAexonicDe novostopgainNM_005045
NM_173054
c.C4726T
c.C4726T
p.R1576X
p.R1576X
45.0-Stessman2017 T
Stessman2017 T
RELN     M17444chr7:
103237104-103237104
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G3338A
c.G3338A
p.G1113E
p.G1113E
27.28.279E-6Stessman2017 T
RELN     TASC_219-2288-1chr7:
103202044-103202044
CTexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.G5464A
c.G5464A
p.G1822S
p.G1822S
35.08.243E-6Wang2020 T
RELN     5-0014-003chr7:
103604771-103604771
AGintronicDe novo--Trost2022 G
Yuen2017 G
RELN     SAGE_411.03chr7:
103136312-103136312
TTAexonicPaternalframeshift insertionNM_005045
NM_173054
c.9226dupT
c.9226dupT
p.Y3076fs
p.Y3076fs
--Wang2020 T
RELN     200675470_1082034721chr7:
103322603-103322603
GAexonicDe novostopgainNM_005045
NM_173054
c.C1249T
c.C1249T
p.Q417X
p.Q417X
39.0-Fu2022 E
RELN     2-1408-004chr7:
103194122-103194122
GTexonicDe novononsynonymous SNVNM_005045
NM_173054
c.C5954A
c.C5954A
p.S1985Y
p.S1985Y
21.0-Trost2022 G
Wang2020 T
Yuen2015 G
Yuen2017 G
Zhou2022 GE
RELN     M30612chr7:
103243834-103243835
GCGexonicPaternalframeshift deletionNM_005045
NM_173054
c.3249delG
c.3249delG
p.W1083fs
p.W1083fs
--Guo2018 T
RELN     Cukier2014:17342chr7:
103234202-103234202
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G3839A
c.G3839A
p.G1280E
p.G1280E
26.20.0102Cukier2014 E
RELN     AU4015301chr7:
103255311-103255311
GAintronicDe novo--Trost2022 G
Yuen2017 G
RELN     M08584chr7:
103126648-103126648
CAexonicMaternalnonsynonymous SNVNM_005045
NM_173054
c.G9979T
c.G9979T
p.A3327S
p.A3327S
35.0-Guo2018 T
Wang2016 T
RELN     SSC06471chr7:
103180706-103180706
GAexonicDe novononsynonymous SNVNM_005045
NM_173054
c.C6868T
c.C6868T
p.R2290C
p.R2290C
26.3-Fu2022 E
Lim2017 E
Trost2022 G
RELN     M20727chr7:
103201980-103201980
CAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G5528T
c.G5528T
p.G1843V
p.G1843V
24.91.0E-4Stessman2017 T
RELN     Ohashi2021:ASD-175chr7:
103185784-103185784
GAexonicnonsynonymous SNVNM_005045
NM_173054
c.C6310T
c.C6310T
p.R2104C
p.R2104C
19.948.395E-6Ohashi2021 ET
RELN     Gecz3_40575chr7:
103230169-103230169
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C4019T
c.C4019T
p.P1340L
p.P1340L
32.01.649E-5Wang2020 T
RELN     AU0903301chr7:
103163929-103163929
GAexonicDe novostopgainNM_005045
NM_173054
c.C7399T
c.C7399T
p.Q2467X
p.Q2467X
49.0-Stessman2017 T
Stessman2017 T
RELN     AU210Achr7:
103162572-103162572
AGexonicDe novo, Unknownnonsynonymous SNVNM_005045
NM_173054
c.T7565C
c.T7565C
p.F2522S
p.F2522S
25.2-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
RELN     Ohashi2021:ASD-149chr7:
103202149-103202149
GAexonicnonsynonymous SNVNM_005045
NM_173054
c.C5359T
c.C5359T
p.R1787W
p.R1787W
23.06.612E-5Ohashi2021 ET
RELN     1255JS0019chr7:
103322603-103322603
GAexonicDe novo, UnknownstopgainNM_005045
NM_173054
c.C1249T
c.C1249T
p.Q417X
p.Q417X
39.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
RELN     Ohashi2021:ASD-079chr7:
103185784-103185784
GAexonicnonsynonymous SNVNM_005045
NM_173054
c.C6310T
c.C6310T
p.R2104C
p.R2104C
19.948.395E-6Ohashi2021 ET
RELN     ACGC_M30330chr7:
103230169-103230169
GAexonicMaternalnonsynonymous SNVNM_005045
NM_173054
c.C4019T
c.C4019T
p.P1340L
p.P1340L
32.01.649E-5Wang2020 T
RELN     AGRE_08C72362chr7:
103230169-103230169
GAexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.C4019T
c.C4019T
p.P1340L
p.P1340L
32.01.649E-5Wang2020 T
RELN     SP0213550chr7:
103234966-103234966
TGintronicDe novo--Trost2022 G
RELN     2-1336-003chr7:
103244510-103244512
AAGAintronicDe novo--Trost2022 G
RELN     1-0803-003chr7:
103227396-103227396
CTintronicDe novo--Trost2022 G
RELN     SP0034525chr7:
103234966-103234966
TGintronicDe novo--Trost2022 G
RELN     3-0460-000chr7:
103166609-103166609
TCintronicDe novo--Trost2022 G
RELN     3-0847-000chr7:
103222624-103222624
GTintronicDe novo--Trost2022 G
RELN     5023chr7:
103126691-103126691
ACexonicDe novononsynonymous SNVNM_005045
NM_173054
c.T9936G
c.T9936G
p.C3312W
p.C3312W
18.231.0E-4Trost2022 G
RELN     AU2000302chr7:
103602608-103602608
AGintronicDe novo--Trost2022 G
Yuen2017 G
RELN     1-0644-003chr7:
103161126-103161126
CTintronicDe novo--Trost2022 G
RELN     AGRE_AU0903301chr7:
103163929-103163929
GAexonicDe novostopgainNM_005045
NM_173054
c.C7399T
c.C7399T
p.Q2467X
p.Q2467X
49.0-Wang2020 T
RELN     MSSNG00131-003chr7:
103318083-103318083
CAintronicDe novo--Trost2022 G
RELN     AGRE_09C81884chr7:
103155785-103155785
CTexonicDe novononsynonymous SNVNM_005045
NM_173054
c.G7966A
c.G7966A
p.D2656N
p.D2656N
34.0-Wang2020 T
RELN     4-0090-003chr7:
103356890-103356890
TCintronicDe novo--Trost2022 G
RELN     1-0191-003chr7:
103280897-103280897
GAintronicDe novo--Trost2022 G
RELN     AGRE_AU0531302chr7:
103207069-103207069
GAexonicDe novostopgainNM_005045
NM_173054
c.C4726T
c.C4726T
p.R1576X
p.R1576X
45.0-Wang2020 T
RELN     REACH000454chr7:
103283305-103283305
CTintronicDe novo--Trost2022 G
RELN     MSSNG00206-003chr7:
103264064-103264064
AGintronicDe novo--Trost2022 G
RELN     98HI0575Achr7:
103131182-103131182
AGexonicDe novononsynonymous SNVNM_005045
NM_173054
c.T9538C
c.T9538C
p.Y3180H
p.Y3180H
16.58-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
RELN     1-0465-003Achr7:
103269669-103269669
CGintronicDe novo--Trost2022 G
RELN     MSSNG00336-003chr7:
103249557-103249557
CTintronicDe novo--Trost2022 G
RELN     AU059003chr7:
103252382-103252382
GTintronicDe novo--Trost2022 G
RELN     ACGC_M26918chr7:
103180699-103180699
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6875A
c.G6875A
p.R2292H
p.R2292H
29.35.771E-5Wang2020 T
RELN     3-0359-000chr7:
103457056-103457056
AGintronicDe novo--Trost2022 G
RELN     ACGC_HEN0049.p1chr7:
103243926-103243926
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G3158A
c.G3158A
p.G1053E
p.G1053E
26.6-Wang2020 T
RELN     2-1425-004chr7:
103511418-103511418
GCTCintronicDe novo--Trost2022 G
RELN     APP_110052-100chr7:
103185636-103185636
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6458A
c.G6458A
p.G2153D
p.G2153D
28.09.061E-5Wang2020 T
RELN     3-0530-000chr7:
103438222-103438223
TGTintronicDe novo--Trost2022 G
RELN     09C90312chr7:
103322603-103322603
GAexonicDe novostopgainNM_005045
NM_173054
c.C1249T
c.C1249T
p.Q417X
p.Q417X
39.0-Neale2012 E
Willsey2013 E
RELN     SanDiego_R8F8Zchr7:
103185636-103185636
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6458A
c.G6458A
p.G2153D
p.G2153D
28.09.061E-5Wang2020 T
RELN     MSSNG00245-003chr7:
103453924-103453924
TAintronicDe novo--Trost2022 G
RELN     MT_45.3chr7:
103382022-103382022
GAintronicDe novo--Trost2022 G
RELN     MSSNG00054-005chr7:
103410833-103410833
GTintronicDe novo--Trost2022 G
RELN     ACGC_GX0575.p1chr7:
103155884-103155884
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G7867A
c.G7867A
p.V2623M
p.V2623M
22.7-Wang2020 T
RELN     4-0090-003chr7:
103356892-103356893
TATintronicDe novo--Trost2022 G
RELN     Li2017:23806chr7:
103629801-103629803
CATCexonicUnknownframeshift deletionNM_173054
NM_005045
N/A
N/A
N/A
N/A
--Li2017 T
RELN     Iowa_172_3_a.2.1chr7:
103557528-103557528
CGexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G331C
c.G331C
p.G111R
p.G111R
18.03-Wang2020 T
RELN     7-0051-003chr7:
103380267-103380267
GTintronicDe novo--Trost2022 G
RELN     Greenwood_Cms6476Bchr7:
103252216-103252216
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C2737T
c.C2737T
p.R913C
p.R913C
29.85.789E-5Wang2020 T
RELN     Gecz4_48176chr7:
103180649-103180649
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6925A
c.G6925A
p.D2309N
p.D2309N
31.04.131E-5Wang2020 T
RELN     Greenwood_Cms23880chr7:
103252216-103252216
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C2737T
c.C2737T
p.R913C
p.R913C
29.85.789E-5Wang2020 T
RELN     APP_109776-100chr7:
103124256-103124256
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C10025T
c.C10025T
p.T3342M
p.T3342M
28.01.648E-5Wang2020 T
RELN     ACGC_HEN0248.p1chr7:
103180649-103180649
CTexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.G6925A
c.G6925A
p.D2309N
p.D2309N
31.04.131E-5Wang2020 T
RELN     5-0030-003chr7:
103612246-103612249
ATGCGCGGintronicDe novo--Trost2022 G
RELN     AU2427303chr7:
103350573-103350573
CTintronicDe novo--Trost2022 G
Yuen2017 G
RELN     SanDiego_M2C4Jchr7:
103123375-103123375
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C10225T
c.C10225T
p.R3409C
p.R3409C
34.03.295E-5Wang2020 T
RELN     Melbourne2_ASD_1304chr7:
103180649-103180649
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6925A
c.G6925A
p.D2309N
p.D2309N
31.04.131E-5Wang2020 T
RELN     ACGC_HN0115.p1chr7:
103193948-103193948
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6032A
c.G6032A
p.R2011H
p.R2011H
20.52.476E-5Wang2020 T
RELN     AU2448301chr7:
103609395-103609395
ATintronicDe novo--Trost2022 G
RELN     1-0292-005chr7:
103495774-103495774
GCintronicDe novo--Trost2022 G
Yuen2017 G
RELN     ACGC_M17503chr7:
103193948-103193948
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6032A
c.G6032A
p.R2011H
p.R2011H
20.52.476E-5Wang2020 T
RELN     AGRE_AU1885302chr7:
103207068-103207068
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G4727A
c.G4727A
p.R1576Q
p.R1576Q
23.4-Wang2020 T
RELN     5-0030-003chr7:
103612242-103612242
AGintronicDe novo--Trost2022 G
RELN     Greenwood_Cms2322bchr7:
103202267-103202267
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C5344T
c.C5344T
p.R1782C
p.R1782C
29.02.0E-4Wang2020 T
RELN     MSSNG00430-003chr7:
103561794-103561794
TTCintronicDe novo--Trost2022 G
RELN     Greenwood_12053chr7:
103202267-103202267
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C5344T
c.C5344T
p.R1782C
p.R1782C
29.02.0E-4Wang2020 T
RELN     MSSNG00021-003chr7:
103601108-103601108
ACintronicDe novo--Trost2022 G
RELN     AGRE_AU0946302chr7:
103183217-103183217
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6632A
c.G6632A
p.R2211H
p.R2211H
29.26.59E-5Wang2020 T
RELN     Leuven2_62774724chr7:
103185741-103185741
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C6353T
c.C6353T
p.P2118L
p.P2118L
34.01.653E-5Wang2020 T
RELN     Leuven2_60885244chr7:
103183217-103183217
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6632A
c.G6632A
p.R2211H
p.R2211H
29.26.59E-5Wang2020 T
RELN     Gecz3_40429chr7:
103557528-103557528
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G331A
c.G331A
p.G111R
p.G111R
18.581.651E-5Wang2020 T
RELN     Leuven_320877chr7:
103185741-103185741
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C6353T
c.C6353T
p.P2118L
p.P2118L
34.01.653E-5Wang2020 T
RELN     AU1885302chr7:
103207068-103207068
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G4727A
c.G4727A
p.R1576Q
p.R1576Q
23.4-Stessman2017 T
RELN     Gecz3_40428chr7:
103557528-103557528
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G331A
c.G331A
p.G111R
p.G111R
18.581.651E-5Wang2020 T
RELN     Leuven2_64646367chr7:
103185741-103185741
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C6353T
c.C6353T
p.P2118L
p.P2118L
34.01.653E-5Wang2020 T
RELN     AGRE_04C24261chr7:
103155835-103155835
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G7916A
c.G7916A
p.R2639H
p.R2639H
34.01.653E-5Wang2020 T
RELN     ACGC_HEN0134.p1chr7:
103138318-103138318
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C8899T
c.C8899T
p.R2967C
p.R2967C
22.91.65E-5Wang2020 T
RELN     ACGC_M17444chr7:
103237104-103237104
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G3338A
c.G3338A
p.G1113E
p.G1113E
27.28.279E-6Wang2020 T
RELN     ACGC_GD0119.p1chr7:
103234887-103234887
GTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C3592A
c.C3592A
p.R1198S
p.R1198S
28.08.239E-6Wang2020 T
RELN     M23639chr7:
103290810-103290810
GAexonicMaternalnonsynonymous SNVNM_005045
NM_173054
c.C1913T
c.C1913T
p.P638L
p.P638L
31.06.621E-5Wang2016 T
RELN     2-1169-003chr7:
103527459-103527459
GAintronicDe novo--Trost2022 G
Yuen2017 G
RELN     AU0452304chr7:
103417669-103417669
TCintronicDe novo--Trost2022 G
Yuen2017 G
RELN     SP0236367chr7:
103159773-103159773
GCexonicnonsynonymous SNVNM_005045
NM_173054
c.C7859G
c.C7859G
p.P2620R
p.P2620R
25.1-Zhou2022 GE
RELN     SP0246687chr7:
103138656-103138656
TAexonicnonsynonymous SNVNM_005045
NM_173054
c.A8711T
c.A8711T
p.D2904V
p.D2904V
25.6-Zhou2022 GE
RELN     2-1466-003chr7:
103761782-103761782
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
RELN     1-0217-003chr7:
103185667-103185667
TTAexonicDe novoframeshift insertionNM_005045
NM_173054
c.6426dupT
c.6426dupT
p.I2143fs
p.I2143fs
--Trost2022 G
Zhou2022 GE
RELN     5-0077-004chr7:
103440413-103440413
AACAGCTATTCATGCTAAAAACTCTCAATAAACTintronicDe novo--Yuen2017 G
RELN     SP0087907chr7:
103474061-103474061
GTexonicDe novononsynonymous SNVNM_005045
NM_173054
c.C396A
c.C396A
p.H132Q
p.H132Q
18.478.277E-6Trost2022 G
Zhou2022 GE
RELN     AU3911301chr7:
103278567-103278567
CGintronicDe novo--Trost2022 G
Yuen2017 G
RELN     MSSNG00362-003chr7:
103185709-103185709
CTexonicDe novononsynonymous SNVNM_005045
NM_173054
c.G6385A
c.G6385A
p.G2129S
p.G2129S
25.8-Trost2022 G
Zhou2022 GE
RELN     SP0074795chr7:
103205653-103205653
GTintronicDe novo--Fu2022 E
RELN     SP0018350chr7:
103338351-103338351
GAexonicDe novosynonymous SNVNM_005045
NM_173054
c.C1092T
c.C1092T
p.L364L
p.L364L
-1.651E-5Fu2022 E
Trost2022 G
Zhou2022 GE
RELN     SP0014554chr7:
103130333-103130333
GAexonicDe novononsynonymous SNVNM_005045
NM_173054
c.C9619T
c.C9619T
p.R3207C
p.R3207C
23.8-Fu2022 E
Trost2022 G
Zhou2022 GE
RELN     SP0016873chr7:
103252242-103252242
CAexonicDe novononsynonymous SNVNM_005045
NM_173054
c.G2711T
c.G2711T
p.G904V
p.G904V
24.6-Trost2022 G
Zhou2022 GE
RELN     PN400504chr7:
103205853-103205853
CTexonicUnknownstopgainNM_005045
NM_173054
c.G5082A
c.G5082A
p.W1694X
p.W1694X
47.0-Leblond2019 E
RELN     M30330chr7:
103230169-103230169
GAexonicMaternalnonsynonymous SNVNM_005045
NM_173054
c.C4019T
c.C4019T
p.P1340L
p.P1340L
32.01.649E-5Guo2018 T
RELN     AU2333302chr7:
103254556-103254556
CGintronicDe novo--Yuen2017 G
RELN     AU2950301chr7:
103713968-103713968
ATintergenicDe novo--Yuen2017 G
RELN     13012.p1chr7:
103180706-103180706
GAexonicDe novo, Unknownnonsynonymous SNVNM_005045
NM_173054
c.C6868T
c.C6868T
p.R2290C
p.R2290C
26.3-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
Zhou2022 GE
RELN     M19655chr7:
103290810-103290810
GAexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.C1913T
c.C1913T
p.P638L
p.P638L
31.06.621E-5Wang2016 T
RELN     M2C4Jchr7:
103123375-103123375
GAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.C10225T
c.C10225T
p.R3409C
p.R3409C
34.03.295E-5Stessman2017 T
RELN     HN0075.p1chr7:
103251224-103251224
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G2926A
c.G2926A
p.E976K
p.E976K
32.0-Guo2018 T
RELN     3-0209-000chr7:
103550986-103550986
CTintronicDe novo--Trost2022 G
Yuen2017 G
RELN     1-0465-003chr7:
103269669-103269669
CGintronicDe novo--Yuen2017 G
RELN     7-0035-003chr7:
103351218-103351218
CTintronicDe novo--Trost2022 G
Yuen2017 G
RELN     7-0119-003chr7:
103316648-103316648
ATintronicDe novo--Trost2022 G
Yuen2017 G
RELN     13322.p1chr7:
103130237-103130237
CTexonicMosaicnonsynonymous SNVNM_005045
NM_173054
c.G9715A
c.G9715A
p.G3239R
p.G3239R
22.4-Krupp2017 E
RELN     03C17165chr7:
103183274-103183274
CGexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6575C
c.G6575C
p.R2192P
p.R2192P
19.53-Stessman2017 T
RELN     TASC_217-14407-5160chr7:
103368644-103368645
TATexonicMaternalstopgainNM_005045
NM_173054
c.666delT
c.666delT
p.C222X
p.C222X
--Wang2020 T
RELN     3-0391-000chr7:
103379660-103379660
GCintronicDe novo--Trost2022 G
Yuen2017 G
RELN     3-0391-000chr7:
103381684-103381684
GCintronicDe novo--Trost2022 G
Yuen2017 G
RELN     ACGC_GX0320.p1chr7:
103393662-103393662
CAsplicingMaternalsplicing13.81-Wang2020 T
RELN     14370.p1chr7:
103627101-103627101
TAintronicDe novo--Turner2016 G
RELN     04C24261chr7:
103155835-103155835
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G7916A
c.G7916A
p.R2639H
p.R2639H
34.01.653E-5Stessman2017 T
RELN     Leuven_359374chr7:
103138305-103138305
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G8912A
c.G8912A
p.R2971Q
p.R2971Q
36.0-Wang2020 T
RELN     175585chr7:
103301936-103301936
CAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G1328T
c.G1328T
p.G443V
p.G443V
24.5-Stessman2017 T
RELN     Leuven_280779chr7:
103124158-103124158
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G10123A
c.G10123A
p.A3375T
p.A3375T
36.01.647E-5Wang2020 T
RELN     AGRE_03C17165chr7:
103183274-103183274
CGexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6575C
c.G6575C
p.R2192P
p.R2192P
19.53-Wang2020 T
RELN     Alvarez-Mora2016:ASD-55chr7:
103234931-103234931
TCexonicMaternalnonsynonymous SNVNM_005045
NM_173054
c.A3548G
c.A3548G
p.Y1183C
p.Y1183C
17.078.257E-6Alvarez-Mora2016 T
RELN     Leuven_175585chr7:
103301936-103301936
CAexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G1328T
c.G1328T
p.G443V
p.G443V
24.5-Wang2020 T
RELN     3-0391-000chr7:
103401126-103401126
GCintronicDe novo--Trost2022 G
Yuen2017 G
RELN     AU2787302chr7:
103354934-103354934
CTintronicDe novo--Trost2022 G
Yuen2017 G
RELN     SanDiego_00918-U9C6Zchr7:
103202090-103202094
GTCTTGexonicUnknownframeshift deletionNM_005045
NM_173054
c.5414_5417del
c.5414_5417del
p.K1805fs
p.K1805fs
--Wang2020 T
RELN     280779chr7:
103124158-103124158
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G10123A
c.G10123A
p.A3375T
p.A3375T
36.01.647E-5Stessman2017 T
RELN     200675470@1082034721chr7:
103322603-103322603
GAexonicDe novostopgainNM_005045
NM_173054
c.C1249T
c.C1249T
p.Q417X
p.Q417X
39.0-Satterstrom2020 E
Trost2022 G
Zhou2022 GE
RELN     217-14407-5160chr7:
103368645-103368646
ACCexonicMaternalstopgainNM_005045
NM_173054
c.666delT
c.666delT
p.C222X
p.C222X
--Stessman2017 T
RELN     359374chr7:
103138305-103138305
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G8912A
c.G8912A
p.R2971Q
p.R2971Q
36.0-Stessman2017 T
RELN     1-0674-003chr7:
103227261-103227261
CTintronicDe novo--Trost2022 G
Yuen2017 G
RELN     219-2288-1chr7:
103202044-103202044
CTexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.G5464A
c.G5464A
p.G1822S
p.G1822S
35.08.243E-6Stessman2017 T
RELN     HEN0248.p1chr7:
103180649-103180649
CTexonicPaternalnonsynonymous SNVNM_005045
NM_173054
c.G6925A
c.G6925A
p.D2309N
p.D2309N
31.04.131E-5Guo2018 T
RELN     2-1215-003chr7:
103742871-103742871
GTintergenicDe novo--Yuen2017 G
RELN     M23847chr7:
103185783-103185783
CTexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.G6311A
c.G6311A
p.R2104H
p.R2104H
33.07.528E-5Guo2018 T
Wang2016 T
RELN     Li2017:16070chr7:
103185633-103185633
TCexonicUnknownnonsynonymous SNVNM_005045
NM_173054
c.A6461G
c.A6461G
p.Y2154C
p.Y2154C
22.28.237E-6Li2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More