
Results for "CDCA7L"

Variant Events: 37

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
CDCA7L     1-0871-003chr7:
GCintergenicDe novo--Yuen2017 G
CDCA7L     AU3716301chr7:
GAintergenicDe novo--Yuen2017 G
CDCA7L     AU3907301chr7:
GAintergenicDe novo--Yuen2017 G
CDCA7L     AU2129301chr7:
AGintergenicDe novo--Yuen2017 G
CDCA7L     AU4089301chr7:
TAintergenicDe novo--Yuen2017 G
CDCA7L     AU046708chr7:
GAintergenicDe novo--Yuen2017 G
CDCA7L     2-1376-003chr7:
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CDCA7L     14106.p1chr7:
CCTUTR3De novo-8.092E-5Satterstrom2020 E
CDCA7L     AU3839303chr7:
AGintronicDe novo--Trost2022 G
Yuen2017 G
CDCA7L     2-1406-003chr7:
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CDCA7L     AU4379301chr7:
TAintergenicDe novo--Yuen2017 G
CDCA7L     09C96222chr7:
GAexonicDe novononsynonymous SNVNM_001127371
21.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Neale2012 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CDCA7L     5-0040-003chr7:
GAintronicDe novo--Trost2022 G
CDCA7L     SJD_15.3chr7:
GCintronicDe novo--Trost2022 G
CDCA7L     SJD_15.3chr7:
GAintronicDe novo--Trost2022 G
CDCA7L     1-0018-003chr7:
CTATATTTTTTTGGAGACAAintronicDe novo--Trost2022 G
CDCA7L     2-1308-003chr7:
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
CDCA7L     1-0452-005chr7:
CTGTTCUTR3De novo-2.0E-4Trost2022 G
CDCA7L     SP0202414chr7:
CTexonicDe novononsynonymous SNVNM_001127371
32.08.246E-6Trost2022 G
CDCA7L     3-0402-000chr7:
GAUTR3De novo-1.0E-4Trost2022 G
CDCA7L     78738chr7:
CCTUTR3De novo-8.092E-5Trost2022 G
CDCA7L     mAGRE5825chr7:
CTsplicingPaternalsplicing22.3-Cirnigliaro2023 G
CDCA7L     2-0145-004chr7:
GGGTAAAintronicDe novo-0.0023Trost2022 G
Yuen2017 G
CDCA7L     1-0669-003chr7:
AGintronicDe novo--Trost2022 G
Yuen2017 G
CDCA7L     1-0518-003chr7:
CTUTR3De novo--Yuen2017 G
CDCA7L     2-0003-004chr7:
CGintronicDe novo--Trost2022 G
Yuen2017 G
CDCA7L     2-1605-004chr7:
CAintergenicDe novo--Yuen2017 G
CDCA7L     MSSNG00413-003chr7:
GCintronicDe novo--Trost2022 G
CDCA7L     AU4069301 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
CDCA7L     MSSNG00418-003chr7:
GAintronicDe novo--Trost2022 G
CDCA7L     1-0215-006chr7:
ATintergenicDe novo--Yuen2017 G
CDCA7L     AU3808305chr7:
GAintergenicDe novo--Yuen2017 G
CDCA7L     1-0022-004chr7:
CAAACAAAAintergenicDe novo--Yuen2017 G
CDCA7L     AU4176302chr7:
ATintergenicDe novo--Yuen2017 G
CDCA7L     2-1646-003chr7:
GAintronicDe novo--Trost2022 G
Yuen2017 G
CDCA7L     SP0110400chr7:
ACintronicDe novo--Fu2022 E
CDCA7L     SP0148202chr7:
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView