or
or
Exact

Results for "MUC4"

Variant Events: 95

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MUC4     mAGRE5023chr3:
195516093-195516095
CTGCexonicPaternalframeshift deletionNM_018406c.2356_2357delp.Q786fs--Cirnigliaro2023 G
MUC4     Shi2013:1chr3:
195510850-195510850
GTexonicInheritednonsynonymous SNVNM_018406c.C7601Ap.A2534D9.8835.0E-4Shi2013 G
MUC4     mAGRE5022chr3:
195516093-195516095
CTGCexonicPaternalframeshift deletionNM_018406c.2356_2357delp.Q786fs--Cirnigliaro2023 G
MUC4     mAGRE1291chr3:
195501120-195501121
TCTexonicPaternalframeshift deletionNM_138297
NM_004532
NM_018406
c.138delG
c.291delG
c.12999delG
p.R46fs
p.R97fs
p.R4333fs
-1.0E-4Cirnigliaro2023 G
MUC4     14240.p1chr3:
195509942-195509942
TTGGTGACAGGAAGCGAGGTGGCGTGACCTGTGAACACTGAGGAAGCGTCexonicDe novononframeshift insertionNM_018406c.8508_8509insGACGCTTCCTCAGTGTTCACAGGTCACGCCACCTCGCTTCCTGTCACCp.I2837delinsDASSVFTGHATSLPVTI--Satterstrom2020 E
MUC4     mAGRE4594chr3:
195538657-195538658
CACexonicPaternalframeshift deletionNM_004532
NM_018406
NM_138297
c.31delT
c.31delT
c.31delT
p.W11fs
p.W11fs
p.W11fs
-2.0E-4Cirnigliaro2023 G
MUC4     12829.p1chr3:
195506022-195506022
CCGTGGTGTCACCTGTTGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGTGTCGGTGACAGGAAGAGGGGTGGCGTGACCGGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGGexonicDe novononframeshift insertionNM_018406c.12428_12429insCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACCGGTCACGCCACCCCTCTTCCTGTCACCGACACTTCCTCAGCATCCACAGGTGACACCACCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCAACAGGTGACACCACp.T4143delinsTPLPVTDASSASTGHATPLPVTDTSSASTGDTTPLPVTDASSASTGQATPLPVTSLSSVSTGDTT--Satterstrom2020 E
MUC4     mAGRE4523chr3:
195538657-195538658
CACexonicPaternalframeshift deletionNM_004532
NM_018406
NM_138297
c.31delT
c.31delT
c.31delT
p.W11fs
p.W11fs
p.W11fs
-2.0E-4Cirnigliaro2023 G
MUC4     14482.p1chr3:
195521459-195521459
CGintronicDe novo--Turner2016 G
MUC4     14023.p1chr3:
195509246-195509246
GTexonicDe novononsynonymous SNVNM_018406c.C9205Ap.H3069N0.006-Lim2017 E
MUC4     SSC08609chr3:
195507684-195507684
GAexonicDe novosynonymous SNVNM_018406c.C10767Tp.D3589D-6.184E-5Fu2022 E
Lim2017 E
MUC4     CC955.201chr3:
195511844-195511844
TGexonicMosaicnonsynonymous SNVNM_018406c.A6607Cp.T2203P4.4173.0E-4Lim2017 E
MUC4     13850.p1chr3:
195509511-195509511
GAexonicMosaicsynonymous SNVNM_018406c.C8940Tp.T2980T--Lim2017 E
MUC4     NDAR_INVNK094EPH_wes1chr3:
195515997-195515997
GTexonicDe novononsynonymous SNVNM_018406c.C2454Ap.S818R5.7428.295E-6DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
MUC4     14208.p1chr3:
195553205-195553206
ACAintergenicDe novo--Wilfert2021 G
MUC4     SP0035459chr3:
195512041-195512041
GAexonicDe novononsynonymous SNVNM_018406c.C6410Tp.T2137I2.3732.0E-4Fu2022 E
MUC4     14091.p1chr3:
195479489-195479490
AGGCintronicMaternal--Wilfert2021 G
MUC4     SP0000855chr3:
195509830-195509974
GACACTGAGGAAGCGTCGGTGACAGGAAGAGAGGTGGCGTGACCTGTGGACACTGAGGAAGCGTCGGTGACAGGAAGAGGGGTGGTGTGACCTGAGGATGCTGAGGAAGGGATGGTGACAGGAAGAGAGGTGGCATGACCTGTGAGexonicDe novononframeshift deletionNM_018406c.8477_8620delp.2826_2874del-0.0011Fu2022 E
MUC4     SP0061824chr3:
195508183-195508183
GAexonicDe novononsynonymous SNVNM_018406c.C10268Tp.T3423I6.3623.0E-4Fu2022 E
MUC4     SP0100556chr3:
195508139-195508139
CTexonicDe novononsynonymous SNVNM_018406c.G10312Ap.A3438T7.0390.0024Fu2022 E
MUC4     SP0047928chr3:
195508547-195508547
TCexonicDe novononsynonymous SNVNM_018406c.A9904Gp.T3302A8.2563.0E-4Fu2022 E
MUC4     SP0031609chr3:
195508499-195508499
CGexonicDe novononsynonymous SNVNM_018406c.G9952Cp.A3318P1.6733.0E-4Fu2022 E
MUC4     2-1207-003chr3:
195512590-195512590
GTexonicDe novononsynonymous SNVNM_018406c.C5861Ap.P1954H2.532-Yuen2017 G
MUC4     SSC12823chr3:
195512542-195512542
GAexonicMosaicnonsynonymous SNVNM_018406c.C5909Tp.P1970L5.066-Lim2017 E
MUC4     SP0012511chr3:
195505957-195505957
TCexonicDe novononsynonymous SNVNM_018406c.A12494Gp.D4165G5.827-Fu2022 E
MUC4     SSC10347chr3:
195512399-195512399
GTexonicMosaicnonsynonymous SNVNM_018406c.C6052Ap.P2018T5.261-Lim2017 E
MUC4     SP0027116chr3:
195515412-195515412
GGGTGGTGACAGGAAGAGGGGTGGCGTGACexonicDe novoframeshift insertionNM_018406c.3038_3039insGTCACGCCACCCCTCTTCCTGTCACCACp.S1013fs--Fu2022 E
MUC4     13196.p1chr3:
195510958-195510958
GCexonicDe novononsynonymous SNVNM_018406c.C7493Gp.P2498R8.811-Krumm2015 E
MUC4     SP0104446chr3:
195508078-195508078
GAexonicDe novononsynonymous SNVNM_018406c.C10373Tp.P3458L7.9366.0E-4Fu2022 E
MUC4     13786.p1chr3:
195509626-195509626
GCexonicDe novononsynonymous SNVNM_018406c.C8825Gp.T2942S5.019-Krumm2015 E
MUC4     SP0028388chr3:
195508030-195508030
GTexonicDe novononsynonymous SNVNM_018406c.C10421Ap.P3474H4.7251.0E-4Fu2022 E
MUC4     SP0130030chr3:
195515291-195515291
TCexonicDe novononsynonymous SNVNM_018406c.A3160Gp.S1054G3.457-Fu2022 E
MUC4     SP0120891chr3:
195513802-195513802
GTexonicDe novononsynonymous SNVNM_018406c.C4649Ap.T1550N6.5981.0E-4Fu2022 E
MUC4     SP0031074chr3:
195508476-195508476
GAexonicDe novosynonymous SNVNM_018406c.C9975Tp.H3325H-6.158E-5Fu2022 E
MUC4     2-1207-003chr3:
195512612-195512612
ATexonicDe novononsynonymous SNVNM_018406c.T5839Ap.S1947T1.5928.033E-5Yuen2017 G
MUC4     SP0069644chr3:
195515326-195515326
GAexonicDe novononsynonymous SNVNM_018406c.C3125Tp.P1042L5.6923.0E-4Fu2022 E
MUC4     SP0090218chr3:
195510011-195510011
CTexonicDe novononsynonymous SNVNM_018406c.G8440Ap.A2814T8.0820.0376Fu2022 E
MUC4     SP0042511chr3:
195509813-195509813
GAexonicDe novononsynonymous SNVNM_018406c.C8638Tp.P2880S5.4189.45E-5Fu2022 E
MUC4     SP0054387chr3:
195513413-195513413
GAexonicDe novononsynonymous SNVNM_018406c.C5038Tp.P1680S7.096-Fu2022 E
MUC4     SP0073058chr3:
195510757-195510757
TAexonicDe novononsynonymous SNVNM_018406c.A7694Tp.D2565V5.4384.0E-4Fu2022 E
MUC4     SP0036976chr3:
195515270-195515390
CAGTGACAGGAAGAGGGGTGCTGTCACCTGTGGATGCTGAGGAAAAGCTGGTGACAGGAAGAGGGGTGACGTGACCTGTGGATTCTGAGGAAGTGTCGGTGACAGGAAGAGGGGTGGTGTGCexonicDe novononframeshift deletionNM_018406c.3061_3180delp.1021_1060del-4.412E-5Fu2022 E
MUC4     2-1741-003chr3:
195532287-195532287
GAintronicDe novo--Yuen2017 G
MUC4     SP0008356chr3:
195506857-195506905
GCTGAGGAAGGGCTAGTGACAGGAAGAGGCATGGTGTCACCTGTGGATAGexonicDe novononframeshift deletionNM_018406c.11546_11593delp.3849_3865del--Fu2022 E
MUC4     SP0110326chr3:
195515403-195515403
TCexonicDe novosynonymous SNVNM_018406c.A3048Gp.S1016S-0.0066Fu2022 E
MUC4     iHART1291chr3:
195501120-195501121
TCTexonicPaternalframeshift deletionNM_138297
NM_004532
NM_018406
c.138delG
c.291delG
c.12999delG
p.R46fs
p.R97fs
p.R4333fs
-1.0E-4Ruzzo2019 G
MUC4     SP0065978chr3:
195513758-195513998
GACCTGTGGATACTGAGGAAGCGTCGGTGACAGGAAGAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTAGTGACAGGAAGAGGCATGGTGTCACCTGTGGATGCTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGAGGAAGGGCTGGTGACATGAAGAGGAGTGACGTGACCTGTGGATGCTGAGGAAGTGCTAGTGACAGGAAGAGGCGTGGTGTCGexonicDe novononframeshift deletionNM_018406c.4453_4692delp.1485_1564del--Fu2022 E
MUC4     1-0518-003chr3:
195488225-195488225
CTintronicDe novo--Yuen2016 G
Yuen2017 G
MUC4     SP0120116chr3:
195507221-195507224
GGGTGexonicDe novononframeshift deletionNM_018406c.11227_11229delp.3743_3743del--Fu2022 E
MUC4     2-1567-003chr3:
195570056-195570056
CCTTintergenicDe novo--Yuen2017 G
MUC4     Shi2013:2chr3:
195510850-195510850
GTexonicInheritednonsynonymous SNVNM_018406c.C7601Ap.A2534D9.8835.0E-4Shi2013 G
MUC4     SSC11006chr3:
195509942-195509942
TTGGTGACAGGAAGCGAGGTGGCGTGACCTGTGAACACTGAGGAAGCGTCexonicDe novononframeshift insertionNM_018406c.8508_8509insGACGCTTCCTCAGTGTTCACAGGTCACGCCACCTCGCTTCCTGTCACCp.I2837delinsDASSVFTGHATSLPVTI--Trost2022 G
MUC4     SSC07098chr3:
195506022-195506022
CCGTGGTGTCACCTGTTGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGTGTCGGTGACAGGAAGAGGGGTGGCGTGACCGGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGGexonicDe novononframeshift insertionNM_018406c.12428_12429insCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACCGGTCACGCCACCCCTCTTCCTGTCACCGACACTTCCTCAGCATCCACAGGTGACACCACCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCAACAGGTGACACCACp.T4143delinsTPLPVTDASSASTGHATPLPVTDTSSASTGDTTPLPVTDASSASTGQATPLPVTSLSSVSTGDTT--Trost2022 G
MUC4     13293.p1chr3:
195509428-195509428
GAexonicDe novononsynonymous SNVNM_018406c.C9023Tp.S3008F7.6874.0E-4Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
MUC4     SSC06608chr3:
195509304-195509350
TGCTGAGGAAGTGTCGGTGACAGGAAGCGGGGTGGCGTGACCGGTGGTexonicDe novoframeshift deletionNM_018406c.9101_9146delp.S3034fs--Trost2022 G
MUC4     Li2017:23673chr3:
195488430-195488430
CTexonicUnknownnonsynonymous SNVNM_138297
NM_004532
NM_018406
c.G1678A
c.G1831A
c.G14539A
p.D560N
p.D611N
p.D4847N
17.43-Li2017 T
MUC4     A24chr3:
195510226-195510226
GGGexonicDe novoframeshift insertionNM_018406c.8225dupCp.T2742fs--Wu2018 G
MUC4     A4chr3:
195513384-195513385
AGAexonicDe novoframeshift deletionNM_018406c.5066delCp.A1689fs--Wu2018 G
MUC4     80001104634chr3:
195506953-195506953
GAexonicDe novononsynonymous SNVNM_018406c.C11498Tp.A3833V6.5035.0E-4Satterstrom2020 E
Trost2022 G
MUC4     09C86928chr3:
195511272-195511279
TGCTGAGGTexonicDe novoframeshift deletionNM_018406c.7172_7178delp.S2391fs-1.0E-4Satterstrom2020 E
Trost2022 G
MUC4     13635.p1chr3:
195507684-195507684
GAexonicDe novosynonymous SNVNM_018406c.C10767Tp.D3589D-6.184E-5Iossifov2014 E
Kosmicki2017 E
MUC4     12573.p1chr3:
195511918-195511918
GTexonicDe novononsynonymous SNVNM_018406c.C6533Ap.P2178H6.5410.0195Iossifov2014 E
Kosmicki2017 E
MUC4     Li2017:39chr3:
195513289-195513289
AAGexonicUnknownframeshift insertionNM_018406c.5161_5162insCp.V1721fs--Li2017 T
MUC4     13741.p1chr3:
195512768-195512768
TAexonicDe novononsynonymous SNVNM_018406c.A5683Tp.N1895Y6.1160.084Iossifov2014 E
Kosmicki2017 E
MUC4     13010.p1chr3:
195509304-195509350
TGCTGAGGAAGTGTCGGTGACAGGAAGCGGGGTGGCGTGACCGGTGGTexonicDe novoframeshift deletionNM_018406c.9101_9146delp.S3034fs--Satterstrom2020 E
MUC4     13598.p1chr3:
195515198-195515198
CGexonicDe novononsynonymous SNVNM_018406c.G3253Cp.D1085H2.218-Iossifov2014 E
Kosmicki2017 E
MUC4     F10405-1chr3:
195517413-195517413
CTexonicDe novosynonymous SNVNM_018406c.G1038Ap.P346P-1.656E-5Fu2022 E
Satterstrom2020 E
Trost2022 G
MUC4     SP0015103chr3:
195486122-195486122
CTexonicDe novosynonymous SNVNM_138297
NM_004532
NM_018406
c.G1998A
c.G2151A
c.G14859A
p.P666P
p.P717P
p.P4953P
-8.249E-5Feliciano2019 E
Fu2022 E
Trost2022 G
MUC4     161008chr3:
195508955-195508957
CCTCexonicDe novoframeshift deletionNM_018406c.9494_9495delp.Q3165fs-2.0E-4Satterstrom2020 E
Trost2022 G
MUC4     08C74343chr3:
195506312-195506399
TGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAACAGGGGTGGCGTGACCTGTGGATGCTGAGGAAGGGCTGGTGACAGGTexonicDe novononframeshift deletionNM_018406c.12052_12138delp.4018_4046del-7.906E-5Satterstrom2020 E
Trost2022 G
MUC4     Li2017:15021chr3:
195513382-195513382
GGAexonicUnknownframeshift insertionNM_018406c.5068_5069insTp.T1690fs--Li2017 T
MUC4     SSC07305chr3:
195505907-195505907
TCexonicDe novononsynonymous SNVNM_018406c.A12544Gp.T4182A12.619.046E-5Fu2022 E
MUC4     EGAN00001101259chr3:
195511739-195511741
CCTCexonicDe novoframeshift deletionNM_018406c.6710_6711delp.Q2237fs--Fu2022 E
MUC4     CC1273_201chr3:
195507445-195507445
TCexonicDe novononsynonymous SNVNM_018406c.A11006Gp.D3669G1.8020.0069Fu2022 E
MUC4     152312chr3:
195507104-195507104
ATexonicDe novononsynonymous SNVNM_018406c.T11347Ap.S3783T2.86-Fu2022 E
MUC4     121852chr3:
195509950-195509950
GTexonicDe novononsynonymous SNVNM_018406c.C8501Ap.P2834H6.820.0011Fu2022 E
MUC4     SSC11757chr3:
195509170-195509170
AGexonicDe novononsynonymous SNVNM_018406c.T9281Cp.L3094P6.3192.0E-4Fu2022 E
MUC4     SSC03274chr3:
195506437-195506437
CTexonicDe novononsynonymous SNVNM_018406c.G12014Ap.S4005N1.137.0E-4Fu2022 E
MUC4     SSC02199chr3:
195506435-195506435
TAexonicDe novononsynonymous SNVNM_018406c.A12016Tp.T4006S1.023-Fu2022 E
MUC4     A000426chr3:
195507064-195507064
GCexonicDe novononsynonymous SNVNM_018406c.C11387Gp.T3796S5.869-Fu2022 E
MUC4     SSC03069chr3:
195506843-195506843
CTexonicDe novononsynonymous SNVNM_018406c.G11608Ap.A3870T8.2270.0011Fu2022 E
MUC4     20-0500310-23chr3:
195510772-195510772
GGGGGTGGTGTCexonicDe novostopgainNM_018406c.7678_7679insGACACCACCCp.S2560_L2561delinsX--Satterstrom2020 E
Trost2022 G
MUC4     SSC06922chr3:
195509031-195509031
GAexonicDe novosynonymous SNVNM_018406c.C9420Tp.T3140T-2.0E-4Fu2022 E
MUC4     11413_p1chr3:
195515339-195515339
CTexonicDe novononsynonymous SNVNM_018406c.G3112Ap.V1038I2.368-Fu2022 E
MUC4     SSC09737chr3:
195510207-195510207
ATexonicDe novosynonymous SNVNM_018406c.T8244Ap.G2748G--Fu2022 E
MUC4     SSC04583chr3:
195509346-195509346
GTexonicDe novosynonymous SNVNM_018406c.C9105Ap.T3035T-0.0019Fu2022 E
MUC4     SSC09920chr3:
195513982-195513982
GAexonicDe novononsynonymous SNVNM_018406c.C4469Tp.P1490L6.273-Fu2022 E
MUC4     08C77861chr3:
195505250-195505250
GAexonicDe novosynonymous SNVNM_004532
NM_018406
c.C159T
c.C12867T
p.T53T
p.T4289T
--Neale2012 E
MUC4     152430chr3:
195511432-195511432
GAexonicDe novononsynonymous SNVNM_018406c.C7019Tp.T2340I3.3652.0E-4Fu2022 E
MUC4     14366_p1chr3:
195515305-195515305
GAexonicDe novononsynonymous SNVNM_018406c.C3146Tp.A1049V5.0462.0E-4Fu2022 E
MUC4     08C72239chr3:
195515257-195515257
GAexonicDe novononsynonymous SNVNM_018406c.C3194Tp.A1065V7.654.0E-4Fu2022 E
MUC4     006654790087-Cchr3:
195507173-195507173
GGGGTGGCGTGACCTGTGGATACTGAGGAAGTGTCGGTGACAGGAAGAGAexonicDe novononframeshift insertionNM_018406c.11277_11278insTCTCTTCCTGTCACCGACACTTCCTCAGTATCCACAGGTCACGCCACCp.P3760delinsSLPVTDTSSVSTGHATP-0.0059Fu2022 E
MUC4     ASC_11207-1chr3:
195513255-195513255
AGexonicDe novosynonymous SNVNM_018406c.T5196Cp.T1732T--Fu2022 E
MUC4     CC1376_202_1chr3:
195510522-195510522
GAexonicDe novosynonymous SNVNM_018406c.C7929Tp.V2643V--Fu2022 E
MUC4     6271020283207-Cchr3:
195509765-195509861
GGGTAGCGTGACCTGTGGACACTGAGGAAGCGTCGGTGACAGGAAGAGGGGTGGCATGACCTGTGGACACTGAGGAAGCGTCGGTGACAGGAAGAGAGexonicDe novononframeshift deletionNM_018406c.8590_8685delp.2864_2895del-6.0E-4Fu2022 E
MUC4     GM182291chr3:
195508043-195508043
TCexonicDe novononsynonymous SNVNM_018406c.A10408Gp.T3470A5.7780.001Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More