or
or
Exact

Results for "TRAPPC11"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TRAPPC11     829_17auchr4:
184605701-184605701
GAintronicDe novo--Fu2022 E
TRAPPC11     1-0465-003achr4:
184679505-184679505
ACintergenicDe novo--Yuen2017 G
TRAPPC11     1-0652-004chr4:
184583281-184583281
GCintronicDe novo--Yuen2017 G
TRAPPC11     13927.p1chr4:
184585051-184585051
GAexonicDe novononsynonymous SNVNM_021942
NM_199053
c.G31A
c.G31A
p.E11K
p.E11K
27.6-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
TRAPPC11     MT_160chr4:
184601362-184601362
AGexonicMaternalnonsynonymous SNVNM_021942
NM_199053
c.A1055G
c.A1055G
p.Q352R
p.Q352R
25.48.239E-6Toma2013 E
TRAPPC11     2-1290-003chr4:
184664174-184664174
ATintergenicDe novo--Yuen2017 G
TRAPPC11     iHART2688chr4:
184600628-184600628
GAexonicMaternalstopgainNM_021942
NM_199053
c.G954A
c.G954A
p.W318X
p.W318X
40.0-Ruzzo2019 G
TRAPPC11     AU3911302chr4:
184658599-184658614
GGTGTAGGTTGTAGTGGGTGTAGGTTGTAGTGTAGGTTGTAGTGintergenicDe novo--Yuen2017 G
TRAPPC11     13927_p1chr4:
184585051-184585051
GAexonicDe novononsynonymous SNVNM_021942
NM_199053
c.G31A
c.G31A
p.E11K
p.E11K
27.6-Fu2022 E
TRAPPC11     1-0482-003chr4:
184688112-184688112
CGintergenicDe novo--Yuen2017 G
TRAPPC11     AU3861301chr4:
184777949-184777949
CAintergenicDe novo--Yuen2017 G
TRAPPC11     2-1567-004chr4:
184709125-184709125
GAintergenicDe novo--Yuen2017 G
TRAPPC11     1-0465-003chr4:
184679505-184679505
ACintergenicDe novo--Yuen2017 G
TRAPPC11     AU3911301chr4:
184658599-184658614
GGTGTAGGTTGTAGTGGGTGTAGGTTGTAGTGTAGGTTGTAGTGintergenicDe novo--Yuen2017 G
TRAPPC11     AU0786305chr4:
184642005-184642005
AGintergenicDe novo--Yuen2017 G
TRAPPC11     1006001chr4:
184629585-184629585
CTexonicDe novononsynonymous SNVNM_021942c.C3215Tp.T1072M17.86.592E-5Fu2022 E
Satterstrom2020 E
TRAPPC11     2-1341-003chr4:
184615338-184615338
AGintronicDe novo--Yuen2017 G
TRAPPC11     2-1341-004chr4:
184585774-184585777
AGACAintronicDe novo--Yuen2017 G
TRAPPC11     SP0059274chr4:
184601217-184601217
ACintronicDe novo--Fu2022 E
TRAPPC11     1-0092-004chr4:
184640394-184640394
CTintergenicDe novo--Yuen2017 G
TRAPPC11     SP0073280chr4:
184618925-184618925
AGexonicDe novononsynonymous SNVNM_021942
NM_199053
c.A2788G
c.A2788G
p.S930G
p.S930G
20.4-Fu2022 E
TRAPPC11     SP0124011chr4:
184614355-184614356
ATAintronicDe novo--Fu2022 E
TRAPPC11     SP0077617chr4:
184614320-184614320
CTintronicDe novo--Fu2022 E
TRAPPC11     SP0130655chr4:
184626143-184626144
TGTexonicDe novoframeshift deletionNM_021942
NM_199053
c.2976delG
c.2976delG
p.M992fs
p.M992fs
--Fu2022 E
TRAPPC11     AU2792302chr4:
184652156-184652156
CGintergenicDe novo--Yuen2017 G
TRAPPC11     1-0439-003chr4:
184736162-184736162
TCintergenicDe novo--Yuen2017 G
TRAPPC11     SP0118594chr4:
184615248-184615248
TCintronicDe novo--Fu2022 E
TRAPPC11     SP0020605chr4:
184614917-184614917
TCintronicDe novo--Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More