or
or
Exact

Results for "GATB"

Variant Events: 30

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GATB     1-0555-003chr4:
152604809-152604809
CTintronicDe novo--Yuen2017 G
GATB     1-0565-004chr4:
153018238-153018238
AGintergenicDe novo--Yuen2017 G
GATB     2-1620-003chr4:
152884984-152884984
GCintergenicDe novo--Yuen2017 G
GATB     2-1644-004chr4:
152663067-152663067
TGintronicDe novo--Yuen2017 G
GATB     AU4212303chr4:
152902193-152902193
TCintergenicDe novo--Yuen2017 G
GATB     7-0151-003chr4:
152879219-152879219
GAintergenicDe novo--Yuen2017 G
GATB     7-0128-003chr4:
152865735-152865735
TAintergenicDe novo--Yuen2017 G
GATB     7-0166-003chr4:
152662439-152662439
CTintronicDe novo--Yuen2017 G
GATB     1-0186-004chr4:
152794478-152794478
CTintergenicDe novo--Yuen2017 G
GATB     AU054303chr4:
152651650-152651650
TCintronicDe novo--Yuen2017 G
GATB     SP0079786chr4:
152680010-152680010
GAexonicDe novononsynonymous SNVNM_004564c.C241Tp.L81F24.4-Fu2022 E
GATB     AU2139301chr4:
152813477-152813477
CTintergenicDe novo--Yuen2017 G
GATB     1623001chr4:
152638205-152638205
GCexonicDe novononsynonymous SNVNM_004564c.C463Gp.Q155E13.918.237E-6Fu2022 E
Satterstrom2020 E
GATB     MT_28chr4:
152622545-152622545
CAexonicPaternalnonsynonymous SNVNM_004564c.G1133Tp.S378I17.328.39E-6Toma2013 E
GATB     1-0404-003chr4:
152687800-152687817
CTATTATTATTATTATTACTATTATTATTATTAintergenicDe novo--Yuen2017 G
GATB     2-1497-003chr4:
152972816-152972816
CTintergenicDe novo--Yuen2017 G
GATB     3-0065-000chr4:
152653144-152653144
CTintronicDe novo--Yuen2017 G
GATB     3C571chr4:
152638237-152638237
ATintronicDe novo--Satterstrom2020 E
GATB     7-0103-003chr4:
152796423-152796423
GCintergenicDe novo--Yuen2017 G
GATB     7-0191-003chr4:
152877712-152877712
TCintergenicDe novo--Yuen2017 G
GATB     1-0522-003chr4:
152948268-152948268
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
GATB     5-0055-004chr4:
152602638-152602638
GAintronicDe novo--Yuen2017 G
GATB     2-1508-003chr4:
152826242-152826242
CTintergenicDe novo--Yuen2017 G
GATB     1-0452-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
GATB     AU3849302chr4:
152666042-152666042
CAintronicDe novo--Yuen2017 G
GATB     1-0160-004chr4:
153014326-153014326
CAintergenicDe novo--Yuen2017 G
GATB     2-0289-003chr4:
152894694-152894694
GAintergenicDe novo--Yuen2017 G
GATB     A11chr4:
152936661-152936661
GAintergenicDe novo--Wu2018 G
GATB     2-1353-003chr4:
153008888-153008888
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
GATB     1-0044-003chr4:
152794482-152794482
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More