or
or
Exact

Results for "CTU2"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTU2     MT_109chr16:
88780568-88780568
CTexonicMaternalnonsynonymous SNVNM_001012759
NM_001012762
c.C1030T
c.C1030T
p.R344W
p.R344W
18.851.667E-5Toma2013 E
CTU2     237-09-111440chr16:
88779329-88779329
CCCCCCTTCCCCGGGCCCTGACCGCCACTCATGCCCCCGAGAGintronicDe novo--Satterstrom2020 E
CTU2     593984664126-Cchr16:
88776877-88777011
TGTGTGTGCGGCCCACTCTCAGATGTGTTTACAGCAGGTGCACAAATCAGAAGCTGGGTCCACAGCGCGTGTGTGCGGCCCACTCTCAGATGTGTTTACAGCAGGTGCACAAATCAGAAGCTGGGTCCACAGTGCTintronicDe novo--Fu2022 E
CTU2     iHART2528chr16:
88781455-88781455
GAsplicingMaternalsplicing10.843.51E-5Ruzzo2019 G
CTU2     161133chr16:
88779224-88779224
GGCCTGCCexonicDe novononframeshift insertionNM_001012759
NM_001012762
c.648_649insCCTGCC
c.648_649insCCTGCC
p.P216delinsPPA
p.P216delinsPPA
--Fu2022 E
CTU2     iHART1080chr16:
88779303-88779303
CTexonicMaternalstopgainNM_001012759
NM_001012762
c.C727T
c.C727T
p.Q243X
p.Q243X
32.0-Ruzzo2019 G
CTU2     iHART2527chr16:
88781455-88781455
GAsplicingMaternalsplicing10.843.51E-5Ruzzo2019 G
CTU2     iHART1244chr16:
88781273-88781273
AACexonicMaternalframeshift insertionNM_001012759
NM_001012762
c.1359dupC
c.1359dupC
p.D453fs
p.D453fs
-8.42E-6Ruzzo2019 G
CTU2     12350.p1chr16:
88779854-88779854
CTexonicMosaicnonsynonymous SNVNM_001012759
NM_001012762
c.C872T
c.C872T
p.T291M
p.T291M
23.55.094E-5Dou2017 E
CTU2     AU4159301chr16:
88773475-88773475
CTintronicDe novo--Yuen2017 G
CTU2     SP0126405chr16:
88779836-88779836
CAexonicDe novononsynonymous SNVNM_001012759
NM_001012762
c.C854A
c.C854A
p.A285D
p.A285D
26.68.419E-6Fu2022 E
CTU2     SP0080963chr16:
88781198-88781198
CGintronicDe novo--Fu2022 E
CTU2     SP0014997chr16:
88779196-88779196
CTexonicDe novononsynonymous SNVNM_001012759
NM_001012762
c.C620T
c.C620T
p.P207L
p.P207L
4.791-Fu2022 E
CTU2     SP0104592chr16:
88780513-88780513
TGintronicDe novo--Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More