or
or
Exact

Results for "UBE3C"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
UBE3C     AU1988302chr7:
156917866-156917866
GAintergenicDe novo--Yuen2017 G
UBE3C     12851.p1chr7:
157049644-157049644
TGexonicDe novononsynonymous SNVNM_014671c.T2987Gp.F996C17.4-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012a T
Satterstrom2020 E
Wilfert2021 G
UBE3C     1-0158-003chr7:
156836386-156836386
GAintergenicDe novo--Yuen2017 G
UBE3C     A1chr7:
156912779-156912779
ACintergenicDe novo--Wu2018 G
UBE3C     14096.p1chr7:
156979601-156979601
AAAexonicMaternalframeshift insertionNM_014671c.1217dupAp.N406fs--O’Roak2012a T
UBE3C     1-0009-004chr7:
156870666-156870666
TCintergenicDe novo--Yuen2017 G
UBE3C     1-0998-003chr7:
157122928-157122929
ACACCCintergenicDe novo--Yuen2017 G
UBE3C     2-1264-003chr7:
157041159-157041159
CTexonicDe novononsynonymous SNVNM_014671c.C2579Tp.A860V18.42-Yuen2016 G
Yuen2017 G
UBE3C     2-1297-003chr7:
156922495-156922495
GAintergenicDe novo--Yuen2017 G
UBE3C     3-0456-000chr7:
156828232-156828232
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
UBE3C     11006.p1chr7:
157041114-157041114
CTexonicDe novononsynonymous SNVNM_014671c.C2534Tp.S845F21.28.237E-6Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
UBE3C     2-1456-003chr7:
156928602-156928602
CTintergenicDe novo--Yuen2017 G
UBE3C     AU2787302chr7:
156885479-156885479
TCintergenicDe novo--Yuen2017 G
UBE3C     AU2950301chr7:
156961114-156961114
AGintronicDe novo--Yuen2017 G
UBE3C     3-0456-000Bchr7:
156828232-156828232
CTintergenicDe novo--Yuen2017 G
UBE3C     Lim2017:5316chr7:
157041114-157041114
CTexonicDe novononsynonymous SNVNM_014671c.C2534Tp.S845F21.28.237E-6Lim2017 E
UBE3C     SSC06297chr7:
157049644-157049644
TGexonicDe novononsynonymous SNVNM_014671c.T2987Gp.F996C17.4-Lim2017 E
UBE3C     D’Gama2015:4999chr7:
156974902-156974902
GAexonicUnknownnonsynonymous SNVNM_014671c.G871Ap.V291I0.5218.238E-5D’Gama2015 T
UBE3C     7-0253-005chr7:
156964126-156964126
GTintronicDe novo--Yuen2017 G
UBE3C     AU4235302chr7:
156887757-156887757
GAintergenicDe novo--Yuen2017 G
UBE3C     1-0560-003chr7:
157075021-157075021
GCintergenicDe novo--Yuen2017 G
UBE3C     1-0181-004chr7:
157022512-157022512
GAintronicDe novo--Yuen2017 G
UBE3C     2-1529-003chr7:
156972539-156972539
CGintronicDe novo--Yuen2017 G
UBE3C     AU031404chr7:
156983304-156983304
CTintronicDe novo--Yuen2017 G
UBE3C     2-0003-004chr7:
156910507-156910507
GAintergenicDe novo--Yuen2017 G
UBE3C     2-0285-003chr7:
156845024-156845024
GAintergenicDe novo--Yuen2017 G
UBE3C     AU3911301chr7:
156871426-156871426
ATintergenicDe novo--Yuen2017 G
UBE3C     AU2975302chr7:
156981232-156981232
GAintronicDe novo--Yuen2017 G
UBE3C     AU3637301chr7:
156894683-156894683
TTATTGGCTGGGATTACAGGCTGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More