or
or
Exact

Results for "NUDCD1"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NUDCD1     13306.p1chr8:
110255473-110255473
GAexonicDe novononsynonymous SNVNM_001128211
NM_032869
c.C1430T
c.C1517T
p.S477L
p.S506L
34.02.475E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
NUDCD1     7-0127-003chr8:
110298543-110298543
CTintronicDe novo--Yuen2017 G
NUDCD1     Lim2017:68751chr8:
110255473-110255473
GAexonicDe novononsynonymous SNVNM_001128211
NM_032869
c.C1430T
c.C1517T
p.S477L
p.S506L
34.02.475E-5Lim2017 E
NUDCD1     iHART2039chr8:
110305657-110305657
GAexonicPaternalstopgainNM_001128211
NM_032869
c.C469T
c.C556T
p.R157X
p.R186X
39.0-Ruzzo2019 G
NUDCD1     iHART2036chr8:
110305657-110305657
GAexonicPaternalstopgainNM_001128211
NM_032869
c.C469T
c.C556T
p.R157X
p.R186X
39.0-Ruzzo2019 G
NUDCD1     2-1116-003chr8:
110298284-110298304
CAATAATAATAATAATAATAACAATAATAATAATAATAAintronicDe novo--Yuen2017 G
NUDCD1     2-1228-003chr8:
110344984-110344984
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NUDCD1     AU4072303chr8:
110324154-110324154
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More