or
or
Exact

Results for "FBXO18"

Variant Events: 9

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FBXO18     1-0173-004chr10:
5951620-5951640
GACAGAAAAATTAGGGGTCTTGintronicDe novo--Yuen2017 G
FBXO18     NDAR_INVGH325XTH_wes1chr10:
5959667-5959667
TCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
FBXO18     ASC_CA_198_Achr10:
5936417-5936417
CGUTR5De novo--Satterstrom2020 E
FBXO18     1-0546-003chr10:
5957009-5957009
TCintronicDe novo--Yuen2017 G
FBXO18     11252.p1chr10:
5963470-5963470
GAexonicDe novononsynonymous SNVNM_001258452
NM_178150
NM_001258453
NM_032807
c.G2038A
c.G2260A
c.G2038A
c.G2413A
p.V680M
p.V754M
p.V680M
p.V805M
21.9-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Sanders2012 E
Satterstrom2020 E
Turner2016 G
FBXO18     11318.p1chr10:
5979124-5979124
CTexonicDe novostopgainNM_178150
NM_001258452
NM_001258453
NM_032807
c.C3013T
c.C2842T
c.C2791T
c.C3166T
p.Q1005X
p.Q948X
p.Q931X
p.Q1056X
41.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
FBXO18     SSC02051chr10:
5963470-5963470
GAexonicDe novononsynonymous SNVNM_001258452
NM_178150
NM_001258453
NM_032807
c.G2038A
c.G2260A
c.G2038A
c.G2413A
p.V680M
p.V754M
p.V680M
p.V805M
21.9-Lim2017 E
FBXO18     AU046706chr10:
5958467-5958469
CAGCintronicDe novo-3.0E-4Yuen2017 G
FBXO18     SSC02409chr10:
5979124-5979124
CTexonicDe novostopgainNM_178150
NM_001258452
NM_001258453
NM_032807
c.C3013T
c.C2842T
c.C2791T
c.C3166T
p.Q1005X
p.Q948X
p.Q931X
p.Q1056X
41.0-Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More