or
or
Exact

Results for "TRAPPC9"

Variant Events: 48

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TRAPPC9     2-1619-004chr8:
140750510-140750510
CTintronicDe novo--Yuen2017 G
TRAPPC9     AU4235303chr8:
140812601-140812601
TCintronicDe novo--Yuen2017 G
TRAPPC9     2-0018-004chr8:
140827693-140827693
TCintronicDe novo--Yuen2017 G
TRAPPC9     3-0065-000chr8:
141305949-141305949
TCintronicDe novo--Yuen2017 G
TRAPPC9     2-1341-004chr8:
140995975-140995975
TCintronicDe novo--Yuen2017 G
TRAPPC9     1-0022-003chr8:
140875159-140875159
CTintronicDe novo--Yuen2016 G
TRAPPC9     1-0004-003chr8:
141173120-141173120
TTTTTACATTATTTGTAAAAintronicDe novo--Yuen2017 G
TRAPPC9     1-0271-003chr8:
141250393-141250393
GAintronicDe novo--Yuen2017 G
TRAPPC9     2-1361-003chr8:
140805375-140805375
CAintronicDe novo--Yuen2016 G
Yuen2017 G
TRAPPC9     1-1000-003chr8:
141182725-141182745
CGCAGCAGCAGCAGCAGCAGCCGCAGCAGCAGCAGCAGCintronicDe novo--Yuen2017 G
TRAPPC9     1-0186-005chr8:
140832287-140832287
GAintronicDe novo--Yuen2017 G
TRAPPC9     1-0068-003chr8:
140889944-140889944
GCintronicDe novo--Yuen2017 G
TRAPPC9     2-0142-004chr8:
140783555-140783555
GAintronicDe novo--Yuen2017 G
TRAPPC9     AU4013302chr8:
141516602-141516602
GCintergenicDe novo--Yuen2017 G
TRAPPC9     1-0534-004chr8:
140916077-140916077
GAintronicDe novo--Yuen2017 G
TRAPPC9     2-1359-003chr8:
141192380-141192380
TCintronicDe novo--Yuen2017 G
TRAPPC9     AU3903301chr8:
141389373-141389373
TCintronicDe novo--Yuen2017 G
TRAPPC9     2-1383-003chr8:
141330167-141330167
GCintronicDe novo--Yuen2017 G
TRAPPC9     AU4032306chr8:
140743396-140743396
GAexonicDe novononsynonymous SNVNM_001160372
NM_031466
c.C3355T
c.C3649T
p.R1119W
p.R1217W
19.122.508E-5Yuen2017 G
TRAPPC9     AU3852301chr8:
141109375-141109375
GAintronicDe novo--Yuen2017 G
TRAPPC9     AU4212303chr8:
140967265-140967265
TCintronicDe novo--Yuen2017 G
TRAPPC9     2-0098-003chr8:
141167195-141167195
GAintronicDe novo--Yuen2017 G
TRAPPC9     AC02-1124-01chr8:
141381255-141381255
GAexonicDe novononsynonymous SNVNM_001160372
NM_031466
c.C1159T
c.C1453T
p.R387C
p.R485C
22.3-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
TRAPPC9     AU4007302chr8:
141029143-141029143
TCintronicDe novo--Yuen2017 G
TRAPPC9     AU049304chr8:
140963732-140963732
CTintronicDe novo--Yuen2017 G
TRAPPC9     13697.p1chr8:
141436659-141436659
TCintronicDe novo--Iossifov2014 E
Kosmicki2017 E
TRAPPC9     1-0104-003chr8:
140991086-140991086
GAintronicDe novo--Yuen2017 G
TRAPPC9     14196.p1chr8:
141468396-141468396
GAexonicDe novononsynonymous SNVNM_031466c.C268Tp.R90C13.71-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TRAPPC9     AU3763305chr8:
140931000-140931000
GAintronicDe novo--Yuen2017 G
TRAPPC9     2-0129-005chr8:
141438492-141438492
TCintronicDe novo--Yuen2017 G
TRAPPC9     2-0158-003chr8:
141157359-141157359
GTintronicDe novo--Yuen2017 G
TRAPPC9     2-0270-004chr8:
141497721-141497721
CTintergenicDe novo--Yuen2017 G
TRAPPC9     AU3913302chr8:
140895941-140895941
TGintronicDe novo--Yuen2017 G
TRAPPC9     Li2017:27906chr8:
141468504-141468504
TTCexonicUnknownframeshift insertionNM_031466c.159dupGp.S54fs--Li2017 T
TRAPPC9     AU3761301chr8:
140848668-140848668
CTintronicDe novo--Yuen2017 G
TRAPPC9     EGAN00001100975chr8:
141445247-141445247
TGexonicDe novononsynonymous SNVNM_001160372
NM_031466
c.A823C
c.A1117C
p.T275P
p.T373P
13.086.658E-5Satterstrom2020 E
TRAPPC9     11341.p1chr8:
140904051-140904051
CGintronicDe novo--Turner2016 G
TRAPPC9     1-0271-004chr8:
141250393-141250393
GAintronicDe novo--Yuen2017 G
TRAPPC9     7-0103-003chr8:
141251337-141251337
AGintronicDe novo--Yuen2017 G
TRAPPC9     Li2017:28507chr8:
141461249-141461249
CTexonicUnknownnonsynonymous SNVNM_001160372
NM_031466
c.G224A
c.G518A
p.R75H
p.R173H
32.08.239E-6Li2017 T
TRAPPC9     1-0065-004chr8:
140920805-140920805
AGintronicDe novo--Yuen2017 G
TRAPPC9     1-0022-004chr8:
140875159-140875159
CTintronicDe novo--Yuen2017 G
TRAPPC9     1-0671-003chr8:
140827252-140827252
GAintronicDe novo--Yuen2017 G
TRAPPC9     1-0806-003chr8:
141099087-141099089
AGGAGintronicDe novo--Yuen2017 G
TRAPPC9     AU0636303chr8:
140973196-140973196
TCintronicDe novo--Yuen2017 G
TRAPPC9     2-1477-003chr8:
140859898-140859939
TGGCCTGGGGATGGGCATGAGCACCTGCCTTCCCGACGGCCCTintronicDe novo--Yuen2016 G
TRAPPC9     Li2017:16097chr8:
141297759-141297760
GTGexonicUnknownframeshift deletionNM_001160372
NM_031466
c.1928delA
c.2222delA
p.Y643fs
p.Y741fs
-8.243E-6Li2017 T
TRAPPC9     2-1460-003chr8:
141273916-141273916
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More