or
or
Exact

Results for "TRRAP"

Variant Events: 44

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TRRAP     M19702chr7:
98529197-98529197
CAexonicMaternalnonsynonymous SNVNM_001244580
NM_003496
c.C3761A
c.C3761A
p.S1254Y
p.S1254Y
35.0-Guo2018 T
Wang2016 T
TRRAP     M15264chr7:
98581031-98581031
GAexonicMaternalnonsynonymous SNVNM_003496
NM_001244580
c.G8896A
c.G8950A
p.D2966N
p.D2984N
32.0-Guo2018 T
Wang2016 T
TRRAP     217-14191-3150chr7:
98608720-98608720
CTexonicPaternalnonsynonymous SNVNM_003496
NM_001244580
c.C10855T
c.C10942T
p.R3619C
p.R3648C
35.0-Stessman2017 T
TRRAP     1-0534-006chr7:
98598668-98598668
CTintronicDe novo--Yuen2017 G
TRRAP     220-9892-201chr7:
98547768-98547769
AAAexonicMaternalframeshift deletionNM_003496
NM_001244580
c.5143delA
c.5197delA
p.K1715fs
p.K1733fs
--Stessman2017 T
TRRAP     1-0455-004chr7:
98574753-98574753
CTintronicDe novo--Yuen2017 G
TRRAP     5-0110-003chr7:
98574117-98574125
TGAGATAAGTGAGATAAGAGATAAGexonicDe novoframeshift insertionNM_003496
NM_001244580
c.7904_7905insAGATAAG
c.7958_7959insAGATAAG
p.S2635fs
p.S2653fs
--Yuen2017 G
TRRAP     GX0040.p1chr7:
98606063-98606063
CGexonicMaternalnonsynonymous SNVNM_003496
NM_001244580
c.C10688G
c.C10775G
p.S3563C
p.S3592C
32.0-Guo2018 T
TRRAP     11828.p1chr7:
98506430-98506430
GAexonicDe novononsynonymous SNVNM_001244580
NM_003496
c.G1195A
c.G1195A
p.V399I
p.V399I
23.43.37E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Sanders2012 E
Satterstrom2020 E
TRRAP     12320.p1chr7:
98550922-98550922
CTexonicDe novononsynonymous SNVNM_003496
NM_001244580
c.C5521T
c.C5575T
p.R1841C
p.R1859C
23.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
TRRAP     14463.p1chr7:
98609859-98609859
CTexonicDe novononsynonymous SNVNM_003496
NM_001244580
c.C11374T
c.C11461T
p.R3792C
p.R3821C
33.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
TRRAP     AU4067303chr7:
98553325-98553325
AGintronicDe novo--Yuen2017 G
TRRAP     M12352chr7:
98567763-98567763
CAexonicPaternalnonsynonymous SNVNM_003496
NM_001244580
c.C7466A
c.C7520A
p.T2489N
p.T2507N
34.0-Guo2018 T
Wang2016 T
TRRAP     PN400343chr7:
98608742-98608742
CTexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.C10877T
c.C10964T
p.A3626V
p.A3655V
33.0-Leblond2019 E
TRRAP     7-0161-003chr7:
98490095-98490095
GAexonicDe novononsynonymous SNVNM_001244580
NM_003496
c.G310A
c.G310A
p.E104K
p.E104K
31.0-Yuen2017 G
TRRAP     PN400104chr7:
98557015-98557015
CTexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.C6316T
c.C6370T
p.R2106C
p.R2124C
33.01.0E-4Leblond2019 E
TRRAP     PN400495chr7:
98557015-98557015
CTexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.C6316T
c.C6370T
p.R2106C
p.R2124C
33.01.0E-4Leblond2019 E
TRRAP     05C40021chr7:
98507709-98507709
CTexonicUnknownnonsynonymous SNVNM_001244580
NM_003496
c.C1381T
c.C1381T
p.R461W
p.R461W
17.668.991E-6Stessman2017 T
TRRAP     M12443chr7:
98609099-98609099
GAexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.G11149A
c.G11236A
p.G3717S
p.G3746S
35.0-Guo2018 T
Wang2016 T
TRRAP     GX0139.p1chr7:
98509724-98509724
GAexonicUnknownnonsynonymous SNVNM_001244580
NM_003496
c.G2087A
c.G2087A
p.R696H
p.R696H
34.09.06E-5Guo2018 T
TRRAP     AU047704chr7:
98523690-98523690
AGintronicDe novo--Yuen2017 G
TRRAP     M16100chr7:
98563456-98563456
CTexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.C7039T
c.C7093T
p.R2347W
p.R2365W
28.68.243E-6Stessman2017 T
TRRAP     1-0467-003chr7:
98542455-98542455
GAintronicDe novo--Yuen2017 G
TRRAP     018-08-108865chr7:
98478841-98478841
AGexonicDe novononsynonymous SNVNM_001244580
NM_003496
c.A68G
c.A68G
p.Q23R
p.Q23R
22.7-Satterstrom2020 E
TRRAP     SSC03986chr7:
98506430-98506430
GAexonicDe novononsynonymous SNVNM_001244580
NM_003496
c.G1195A
c.G1195A
p.V399I
p.V399I
23.43.37E-5Lim2017 E
TRRAP     PN400564chr7:
98557015-98557015
CTexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.C6316T
c.C6370T
p.R2106C
p.R2124C
33.01.0E-4Leblond2019 E
TRRAP     EGAN00001101241chr7:
98478825-98478825
ATexonicDe novononsynonymous SNVNM_001244580
NM_003496
c.A52T
c.A52T
p.M18L
p.M18L
17.63-Satterstrom2020 E
TRRAP     M13288chr7:
98581031-98581031
GAexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.G8896A
c.G8950A
p.D2966N
p.D2984N
32.0-Guo2018 T
Wang2016 T
TRRAP     AU3760301chr7:
98521301-98521301
CTintronicDe novo--Yuen2017 G
TRRAP     NDAR_INVLH429WK1_wes1 Complex Event; expand row to view variants  De novo--Kosmicki2017 E
Kosmicki2017 E
Satterstrom2020 E
Satterstrom2020 E
TRRAP     NDAR_INVLH429WK1_wes1chr7:
98567934-98567934
AGintronicDe novo-8.71E-6Kosmicki2017 E
Satterstrom2020 E
TRRAP     A4chr7:
98480488-98480488
GAintronicDe novo--Wu2018 G
TRRAP     SSC11926chr7:
98609859-98609859
CTexonicDe novononsynonymous SNVNM_003496
NM_001244580
c.C11374T
c.C11461T
p.R3792C
p.R3821C
33.0-Lim2017 E
TRRAP     1-0553-003chr7:
98529088-98529088
GAexonicDe novononsynonymous SNVNM_001244580
NM_003496
c.G3652A
c.G3652A
p.A1218T
p.A1218T
18.188.304E-6Yuen2017 G
TRRAP     AU4152303chr7:
98604961-98604961
AGintronicDe novo--Yuen2017 G
TRRAP     GX0499.p1chr7:
98563453-98563453
CTexonicPaternalnonsynonymous SNVNM_003496
NM_001244580
c.C7036T
c.C7090T
p.L2346F
p.L2364F
32.08.242E-6Guo2018 T
TRRAP     AU4314302chr7:
98529978-98529978
CAintronicDe novo--Yuen2017 G
TRRAP     PN400498chr7:
98557015-98557015
CTexonicUnknownnonsynonymous SNVNM_003496
NM_001244580
c.C6316T
c.C6370T
p.R2106C
p.R2124C
33.01.0E-4Leblond2019 E
TRRAP     11252.p1chr7:
98597317-98597317
ACintronicDe novo--Turner2016 G
TRRAP     DEASD_0398_001chr7:
98478779-98478779
GAexonicDe novosynonymous SNVNM_001244580
NM_003496
c.G6A
c.G6A
p.A2A
p.A2A
-3.0E-4DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
TRRAP     M23651chr7:
98586515-98586515
GAexonicPaternalnonsynonymous SNVNM_003496
NM_001244580
c.G9442A
c.G9529A
p.V3148M
p.V3177M
31.08.272E-6Guo2018 T
Wang2016 T
TRRAP     M31989chr7:
98529197-98529197
CAexonicPaternalnonsynonymous SNVNM_001244580
NM_003496
c.C3761A
c.C3761A
p.S1254Y
p.S1254Y
35.0-Guo2018 T
TRRAP     M17431chr7:
98529286-98529286
GCexonicPaternalnonsynonymous SNVNM_001244580
NM_003496
c.G3850C
c.G3850C
p.E1284Q
p.E1284Q
31.0-Guo2018 T
Wang2016 T
TRRAP     M23044chr7:
98508848-98508848
CTexonicUnknownnonsynonymous SNVNM_001244580
NM_003496
c.C1961T
c.C1961T
p.T654M
p.T654M
32.0-Guo2018 T
Wang2016 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More