or
or
Exact

Results for "TRPM3"

Variant Events: 82

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TRPM3     1-0464-003chr9:
74169525-74169539
ATCTCTCTCTCTCTCATCTCTCTCTCTCintergenicDe novo--Yuen2017 G
TRPM3     1-0041-003chr9:
73755344-73755344
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     1-0224-004chr9:
73574092-73574093
ATAintronicDe novo--Yuen2017 G
TRPM3     2-1508-003chr9:
73874454-73874454
TGintergenicDe novo--Yuen2017 G
TRPM3     2-0018-004chr9:
73946555-73946555
GGAGGAGGAGAAAintergenicDe novo--Yuen2017 G
TRPM3     2-0307-003chr9:
73456923-73456923
CTintronicDe novo--Yuen2017 G
TRPM3     AU051504chr9:
74238745-74238745
TCintergenicDe novo--Yuen2017 G
TRPM3     1-0339-004chr9:
73851102-73851102
TCintergenicDe novo--Yuen2017 G
TRPM3     2-1627-003chr9:
74166239-74166239
ACintergenicDe novo--Yuen2017 G
TRPM3     5-0114-003chr9:
73251013-73251013
CTintronicDe novo--Yuen2017 G
TRPM3     1-0445-003chr9:
73393888-73393889
CACintronicDe novo--Yuen2017 G
TRPM3     1-0139-003chr9:
73513645-73513645
AGintronicDe novo--Yuen2017 G
TRPM3     3-0169-000chr9:
73607807-73607807
CTintronicDe novo--Yuen2016 G
TRPM3     2-1511-003chr9:
73309458-73309458
GAintronicDe novo--Yuen2017 G
TRPM3     1-0708-003chr9:
73799573-73799573
GAintergenicDe novo--Yuen2017 G
TRPM3     2-1382-003chr9:
73811058-73811071
CATATATATATATACATATATATATAintergenicDe novo--Yuen2017 G
TRPM3     13791.p1chr9:
73205891-73205891
AGintronicDe novo--Satterstrom2020 E
TRPM3     1-0068-003chr9:
74031915-74031915
AGintergenicDe novo--Yuen2017 G
TRPM3     2-0081-003chr9:
73675100-73675100
TCintronicDe novo--Yuen2017 G
TRPM3     2-0081-003chr9:
73461758-73461758
GAintronicDe novo--Yuen2017 G
TRPM3     1-0454-003chr9:
73522174-73522174
GAintronicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     AU4089302chr9:
73852690-73852690
GCintergenicDe novo--Yuen2017 G
TRPM3     1-0835-003chr9:
73890084-73890084
CTintergenicDe novo--Yuen2017 G
TRPM3     2-0081-003chr9:
74106346-74106346
TTAAintergenicDe novo--Yuen2017 G
TRPM3     2-0081-003chr9:
73991216-73991216
AGintergenicDe novo--Yuen2017 G
TRPM3     2-1180-003chr9:
73864171-73864171
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     2-1510-003chr9:
73538759-73538774
TACACACACACACACATACACACACACACAintronicDe novo--Yuen2017 G
TRPM3     2-1290-003chr9:
73556078-73556078
GAintronicDe novo--Yuen2017 G
TRPM3     1-0804-003chr9:
73820396-73820396
CAintergenicDe novo--Yuen2017 G
TRPM3     1-0435-003chr9:
73736541-73736541
CAupstreamDe novo--Yuen2017 G
TRPM3     AU075207chr9:
73792081-73792081
CGintergenicDe novo--Yuen2017 G
TRPM3     2-0012-004chr9:
73715901-73715901
TCintronicDe novo--Yuen2017 G
TRPM3     AU2139305chr9:
73816350-73816350
GAintergenicDe novo--Yuen2017 G
TRPM3     2-1371-003chr9:
73921102-73921102
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     AU047704chr9:
73756642-73756642
TGintergenicDe novo--Yuen2017 G
TRPM3     1-0995-003chr9:
73301957-73301957
CTintronicDe novo--Yuen2017 G
TRPM3     1-0300-003chr9:
74254718-74254718
TCintergenicDe novo--Yuen2017 G
TRPM3     1-0551-004chr9:
73809603-73809603
CGintergenicDe novo--Yuen2017 G
TRPM3     1-0300-003chr9:
73577592-73577592
AGintronicDe novo--Yuen2017 G
TRPM3     AU3905301chr9:
74013392-74013392
GAintergenicDe novo--Yuen2017 G
TRPM3     08C73898chr9:
73376396-73376396
GCintronicDe novo0.9-Satterstrom2020 E
TRPM3     2-1182-003chr9:
73747215-73747215
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     1-0408-003chr9:
74121691-74121691
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     A3chr9:
73433721-73433721
AGintronicDe novo--Wu2018 G
TRPM3     AU050604chr9:
74294837-74294837
GCintergenicDe novo--Yuen2017 G
TRPM3     1-0299-004chr9:
74234141-74234141
GAintergenicDe novo--Yuen2017 G
TRPM3     AU3646301chr9:
73475868-73475868
ACintronicDe novo--Yuen2017 G
TRPM3     1-0004-003chr9:
74258504-74258504
GAintergenicDe novo--Yuen2017 G
TRPM3     1-0763-003chr9:
73289432-73289432
GAintronicDe novo--Yuen2017 G
TRPM3     AU2495302chr9:
74022793-74022793
TCintergenicDe novo--Yuen2017 G
TRPM3     1-0354-006chr9:
73174502-73174502
GGTintronicDe novo--Yuen2017 G
TRPM3     DEASD_0051_001chr9:
73736294-73736294
ACUTR5De novo-8.918E-6Kosmicki2017 E
Satterstrom2020 E
TRPM3     1-0010-003chr9:
74229355-74229355
CTintergenicDe novo--Yuen2017 G
TRPM3     2-1330-003chr9:
73481681-73481681
ATintronicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     1-0556-003chr9:
73615883-73615883
CTintronicDe novo--Yuen2017 G
TRPM3     1-0563-003chr9:
73523306-73523306
TGintronicDe novo--Yuen2017 G
TRPM3     2-1066-003chr9:
73223666-73223666
GGACTCintronicDe novo--Yuen2017 G
TRPM3     iHART1559chr9:
73150908-73150918
TCTGGACAGTCTexonicMaternalframeshift deletionNM_206944
NM_001007471
NM_020952
NM_206945
NM_206947
NM_024971
NM_206946
c.4586_4595del
c.5075_5084del
c.4616_4625del
c.4622_4631del
c.4661_4670del
c.4652_4661del
c.4691_4700del
p.R1529fs
p.R1692fs
p.R1539fs
p.R1541fs
p.R1554fs
p.R1551fs
p.R1564fs
--Ruzzo2019 G
TRPM3     2-1107-003chr9:
73988845-73988845
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     3-0391-000chr9:
73687654-73687654
CGintronicDe novo--Yuen2017 G
TRPM3     A27chr9:
73997571-73997571
CGintergenicDe novo--Wu2018 G
TRPM3     1-0289-003chr9:
74106346-74106346
TTAAintergenicDe novo--Yuen2017 G
TRPM3     1-0609-003chr9:
73619480-73619480
TCintronicDe novo--Yuen2017 G
TRPM3     AU076705chr9:
74091562-74091562
AGintergenicDe novo--Yuen2017 G
TRPM3     7-0012-003chr9:
73684760-73684760
GAintronicDe novo--Yuen2017 G
TRPM3     AU4426303chr9:
73231136-73231136
CTintronicDe novo--Yuen2017 G
TRPM3     11782.p1chr9:
73151650-73151652
AGTAexonicDe novoframeshift deletionNM_206944
NM_001007471
NM_020952
NM_206945
NM_206947
NM_024971
NM_206946
c.3852_3853del
c.4341_4342del
c.3882_3883del
c.3888_3889del
c.3927_3928del
c.3918_3919del
c.3957_3958del
p.T1284fs
p.T1447fs
p.T1294fs
p.T1296fs
p.T1309fs
p.T1306fs
p.T1319fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
TRPM3     AU3807302chr9:
73497131-73497131
CGintronicDe novo--Yuen2017 G
TRPM3     2-1131-003chr9:
73994312-73994312
TCintergenicDe novo--Yuen2016 G
TRPM3     2-1168-003chr9:
73306101-73306101
GAintronicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     2-1579-003chr9:
74139105-74139105
GAintergenicDe novo--Yuen2017 G
TRPM3     AU079605chr9:
73895195-73895195
CTintergenicDe novo--Yuen2017 G
TRPM3     1-0054-003chr9:
74251532-74251532
CTintergenicDe novo--Yuen2017 G
TRPM3     AU2109301chr9:
73157356-73157356
CTintronicDe novo--Yuen2017 G
TRPM3     13393.p1chr9:
73790005-73790005
GAintergenicDe novo--Turner2016 G
TRPM3     1-0225-003chr9:
73881705-73881705
CTintergenicDe novo--Yuen2017 G
TRPM3     14590.p1chr9:
74247904-74247904
CTintergenicDe novo--Turner2016 G
TRPM3     2-1373-003chr9:
73873500-73873500
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
TRPM3     AU3951301chr9:
73486314-73486314
CTintronicDe novo--Yuen2017 G
TRPM3     1-0232-004chr9:
73513341-73513341
AGintronicDe novo--Yuen2017 G
TRPM3     2-0214-003chr9:
74161227-74161227
AGintergenicDe novo--Yuen2017 G
TRPM3     NP079chr9:
73376388-73376388
TCintronicDe novo--Lim2017 E
Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More