or
or
Exact

Results for "BLK"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BLK     11024.p1chr8:
11403624-11403624
GTintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
BLK     11845.p1chr8:
11415531-11415531
TCexonicDe novononsynonymous SNVNM_001715c.T1013Cp.I338T17.594.944E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
BLK     EGAN00001101029chr8:
11415431-11415431
TGintronicDe novo-2.0E-4Satterstrom2020 E
BLK     AU3951302chr8:
11364761-11364761
AGintronicDe novo--Yuen2017 G
BLK     1-0507-003chr8:
11432307-11432307
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
BLK     09C99821chr8:
11420448-11420448
CTintronicDe novo-3.335E-5Satterstrom2020 E
BLK     2-1266-003chr8:
11420448-11420448
CTintronicDe novo-3.335E-5Yuen2016 G
Yuen2017 G
BLK     5-0003-004chr8:
11419919-11419919
CTintronicDe novo--Yuen2017 G
BLK     1-0565-003chr8:
11429098-11429098
GAintergenicDe novo--Yuen2017 G
BLK     AU3951302chr8:
11369771-11369771
CTintronicDe novo--Yuen2017 G
BLK     AU3951302chr8:
11377760-11377760
ACintronicDe novo--Yuen2017 G
BLK     1-0526-003chr8:
11410618-11410618
GGCAintronicDe novo--Yuen2017 G
BLK     2-1254-003chr8:
11410618-11410632
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
BLK     AU057405chr8:
11352759-11352759
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More