or
or
Exact

Results for "ADGRB1"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADGRB1     2-1167-003chr8:
143548546-143548546
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ADGRB1     AU3801301chr8:
143547852-143547852
GAintronicDe novo--Yuen2017 G
ADGRB1     F10340-1chr8:
143618370-143618370
GAexonicDe novononsynonymous SNVNM_001702c.G3593Ap.R1198H32.05.747E-5Satterstrom2020 E
ADGRB1     AU2139305chr8:
143601395-143601402
ATGGTGGTATGGTintronicDe novo--Yuen2017 G
ADGRB1     14437.p1chr8:
143648735-143648735
GCintergenicDe novo--Wilfert2021 G
ADGRB1     AU3764302chr8:
143601395-143601402
ATGGTGGTATGGTintronicDe novo--Yuen2017 G
ADGRB1     AU3861302chr8:
143677115-143677115
CTintergenicDe novo--Yuen2017 G
ADGRB1     SSC08014chr8:
143605599-143605599
CGexonicDe novostopgainNM_001702c.C3246Gp.Y1082X42.0-Lim2017 E
ADGRB1     11463.p1chr8:
143604104-143604104
CTintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
ADGRB1     2-1511-003chr8:
143545613-143545631
ACTGCTGCTGCTGCTGCTGACTGCTGCTGCTGCTGexonicDe novononframeshift deletionNM_001702c.70_72delp.24_24del--Yuen2017 G
ADGRB1     13634.p1chr8:
143605599-143605599
CGexonicDe novostopgainNM_001702c.C3246Gp.Y1082X42.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
ADGRB1     2-1163-003chr8:
143687515-143687515
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRB1     JASD_Fam0012chr8:
143592361-143592361
AGexonicDe novononsynonymous SNVNM_001702c.A2744Gp.D915G15.3-Takata2018 E
ADGRB1     1-0277-003chr8:
143675084-143675084
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRB1     AU2381302chr8:
143653258-143653258
GAintergenicDe novo--Yuen2017 G
ADGRB1     142444chr8:
143558712-143558712
GAintronicDe novo-8.873E-6Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More