or
or
Exact

Results for "PPP1R9A"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PPP1R9A     2-0028-003chr7:
94897707-94897707
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PPP1R9A     7-0130-003chr7:
94905378-94905378
ATintronicDe novo--Yuen2017 G
PPP1R9A     13037.p1chr7:
94539985-94539985
CTexonicMosaic Pat., De novononsynonymous SNVNM_001166161
NM_001166162
NM_001166163
NM_001166160
NM_017650
c.C560T
c.C560T
c.C560T
c.C560T
c.C560T
p.S187F
p.S187F
p.S187F
p.S187F
p.S187F
21.0-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
PPP1R9A     2-1206-003chr7:
94612284-94612284
AGintronicDe novo--Yuen2017 G
PPP1R9A     1-0272-003chr7:
94837066-94837071
AATAATAintronicDe novo--Yuen2017 G
PPP1R9A     A18chr7:
94714346-94714346
AGintronicDe novo--Wu2018 G
PPP1R9A     iHART2255chr7:
94903407-94903407
CTexonicMaternalstopgainNM_001166161
NM_001166162
NM_001166160
c.C3103T
c.C3157T
c.C3223T
p.R1035X
p.R1053X
p.R1075X
42.06.84E-5Ruzzo2019 G
PPP1R9A     1-0706-003chr7:
94908170-94908170
TCintronicDe novo--Yuen2017 G
PPP1R9A     AU3634301chr7:
94632856-94632856
GTintronicDe novo--Yuen2017 G
PPP1R9A     1-0104-004chr7:
94668098-94668098
CTintronicDe novo--Yuen2017 G
PPP1R9A     1-1004-003chr7:
94833905-94833919
AACACACACACACACAACACACACACACintronicDe novo--Yuen2017 G
PPP1R9A     1-0278-003chr7:
94682499-94682499
TAintronicDe novo--Yuen2016 G
PPP1R9A     AU4054301chr7:
94707716-94707716
ACintronicDe novo--Yuen2017 G
PPP1R9A     AU2433302chr7:
94885634-94885634
TAintronicDe novo--Yuen2017 G
PPP1R9A     AU175Achr7:
94881043-94881043
AGintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
PPP1R9A     AU3874301chr7:
94559048-94559059
GAGATAGATAGAGAGATAGAintronicDe novo--Yuen2017 G
PPP1R9A     AU1952305chr7:
94828844-94828844
TAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More