or
or
Exact

Results for "NTRK2"

Variant Events: 41

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NTRK2     1-0518-003chr9:
88089782-88089782
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
NTRK2     1-0051-005chr9:
87618968-87618968
GGAAintronicDe novo--Yuen2017 G
NTRK2     1-0497-003chr9:
87728344-87728361
ATGTGTGTGTGTGTGTGTATGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
NTRK2     2-0142-003chr9:
87857050-87857050
CCCATintergenicDe novo--Yuen2017 G
NTRK2     3-0458-000Bchr9:
87394864-87394864
AGintronicDe novo--Yuen2017 G
NTRK2     5-0095-003chr9:
87630693-87630693
TCintronicDe novo--Yuen2017 G
NTRK2     7-0059-003chr9:
87618911-87618911
GGAAintronicDe novo--Yuen2017 G
NTRK2     1-0487-003chr9:
87900984-87900984
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
NTRK2     1-0347-003chr9:
87684352-87684352
CGintergenicDe novo--Yuen2017 G
NTRK2     2-0110-003chr9:
87931274-87931274
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NTRK2     5-0018-003chr9:
87403157-87403157
AGintronicDe novo--Yuen2017 G
NTRK2     AU4365302chr9:
87886070-87886070
ATintergenicDe novo--Yuen2017 G
NTRK2     1-1000-003chr9:
87622918-87622918
CTintronicDe novo--Yuen2017 G
NTRK2     2-0214-004chr9:
87317908-87317908
CTintronicDe novo--Yuen2017 G
NTRK2     2-0295-003chr9:
87676965-87676965
TCintergenicDe novo--Yuen2017 G
NTRK2     3-0458-000chr9:
87394864-87394864
AGintronicDe novo--Yuen2016 G
NTRK2     2-0007-003chr9:
87738909-87738909
GAintergenicDe novo--Yuen2017 G
NTRK2     2-0299-005chr9:
87434180-87434180
CTintronicDe novo--Yuen2017 G
NTRK2     2-1511-003chr9:
88116583-88116583
GAintergenicDe novo--Yuen2017 G
NTRK2     AU3918301chr9:
88056624-88056624
GAintergenicDe novo--Yuen2017 G
NTRK2     2-0081-003chr9:
87684757-87684757
GAintergenicDe novo--Yuen2017 G
NTRK2     2-0081-003chr9:
87583876-87583876
AGintronicDe novo--Yuen2017 G
NTRK2     2-0081-003chr9:
87352111-87352111
CTintronicDe novo--Yuen2017 G
NTRK2     AU3885304chr9:
87404117-87404117
AGintronicDe novo--Yuen2017 G
NTRK2     2-0149-004chr9:
87563499-87563499
CTexonicDe novosynonymous SNVNM_001018064
NM_006180
c.C1839T
c.C1887T
p.L613L
p.L629L
--Yuen2017 G
NTRK2     AU4372309chr9:
87786535-87786535
TCintergenicDe novo--Yuen2017 G
NTRK2     2-0295-004chr9:
87676965-87676965
TCintergenicDe novo--Yuen2017 G
NTRK2     2-0081-003chr9:
87959903-87959903
GAintergenicDe novo--Yuen2017 G
NTRK2     2-0081-003chr9:
87897702-87897702
ACintergenicDe novo--Yuen2017 G
NTRK2     1-0289-004chr9:
88094321-88094321
ATintergenicDe novo--Yuen2017 G
NTRK2     ASC_CA_58_Achr9:
87367033-87367033
GTintronicDe novo--Satterstrom2020 E
NTRK2     1-0300-003chr9:
87974120-87974121
CTCintergenicDe novo--Yuen2017 G
NTRK2     AU4154303chr9:
87482242-87482242
CTexonicDe novononsynonymous SNVNM_001018064
NM_001018066
NM_001018065
NM_006180
c.C1481T
c.C1481T
c.C1529T
c.C1529T
p.S494L
p.S494L
p.S510L
p.S510L
17.29-Yuen2017 G
NTRK2     14626.p1chr9:
87338598-87338598
GTexonicDe novononsynonymous SNVNM_001018064
NM_001007097
NM_001018065
NM_001018066
NM_001291937
NM_006180
c.G694T
c.G694T
c.G694T
c.G694T
c.G694T
c.G694T
p.V232F
p.V232F
p.V232F
p.V232F
p.V232F
p.V232F
14.4-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
NTRK2     2-0306-004chr9:
88070045-88070045
CTintergenicDe novo--Yuen2017 G
NTRK2     3-0458-000Achr9:
87394864-87394864
AGintronicDe novo--Yuen2017 G
NTRK2     1-0520-003chr9:
87754512-87754512
CTintergenicDe novo--Yuen2016 G
NTRK2     2-1154-003chr9:
88123104-88123104
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
NTRK2     Lim2017:37046chr9:
87338598-87338598
GTexonicDe novononsynonymous SNVNM_001018064
NM_001007097
NM_001018065
NM_001018066
NM_001291937
NM_006180
c.G694T
c.G694T
c.G694T
c.G694T
c.G694T
c.G694T
p.V232F
p.V232F
p.V232F
p.V232F
p.V232F
p.V232F
14.4-Lim2017 E
NTRK2     1-0652-003chr9:
88039082-88039082
CGintergenicDe novo--Yuen2017 G
NTRK2     2-0713-003chr9:
87355019-87355019
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More