or
or
Exact

Results for "THEMIS"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
THEMIS     1-0467-003chr6:
128069813-128069813
TCintronicDe novo--Yuen2017 G
THEMIS     AU4310301chr6:
128120486-128120486
GAintronicDe novo--Yuen2017 G
THEMIS     1-0965-003chr6:
128206455-128206455
TCintronicDe novo--Yuen2017 G
THEMIS     1-0912-003chr6:
128235145-128235145
GAintronicDe novo--Yuen2017 G
THEMIS     2-0295-003chr6:
128110671-128110671
GAintronicDe novo--Yuen2017 G
THEMIS     iHART3295chr6:
128128360-128128360
CTsplicingPaternalsplicing0.663-Ruzzo2019 G
THEMIS     1-0336-003chr6:
128217195-128217195
TTAintronicDe novo--Yuen2017 G
THEMIS     1-0344-003chr6:
128091429-128091429
AGintronicDe novo--Yuen2017 G
THEMIS     AU3807302chr6:
128224437-128224437
TCintronicDe novo--Yuen2017 G
THEMIS     iHART2682chr6:
128134565-128134566
CACexonicPaternalframeshift deletionNM_001010923
NM_001164685
NM_001164687
c.1220delT
c.1220delT
c.1115delT
p.V407fs
p.V407fs
p.V372fs
-8.252E-6Ruzzo2019 G
THEMIS     iHART2145chr6:
128134234-128134238
TACTATexonicMaternalframeshift deletionNM_001010923
NM_001164685
NM_001164687
c.1548_1551del
c.1548_1551del
c.1443_1446del
p.V516fs
p.V516fs
p.V481fs
-8.243E-6Ruzzo2019 G
THEMIS     7-0103-003chr6:
128271473-128271473
TAintergenicDe novo--Yuen2017 G
THEMIS     AU4468301chr6:
128045769-128045769
TCintronicDe novo--Yuen2017 G
THEMIS     1-0197-003chr6:
128033892-128033896
CTAAACintronicDe novo--Yuen2017 G
THEMIS     7-0215-003chr6:
128078581-128078593
CATATATATATATCATATATATATintronicDe novo--Yuen2017 G
THEMIS     1-0112-004chr6:
128261024-128261024
CAintergenicDe novo--Yuen2017 G
THEMIS     12153.p1chr6:
128151058-128151058
TCexonicDe novononsynonymous SNVNM_001010923
NM_001164685
NM_001164687
c.A272G
c.A272G
c.A167G
p.D91G
p.D91G
p.D56G
19.61-Ji2016 E
Krumm2015 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More