or
or
Exact

Results for "CTNNA3"

Variant Events: 93

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTNNA3     2-1160-003chr10:
69348785-69348785
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA3     2-1371-003chr10:
69457905-69457905
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CTNNA3     A6chr10:
67793267-67793267
TCintronicDe novo--Wu2018 G
CTNNA3     A6chr10:
68266538-68266538
TCintronicDe novo--Wu2018 G
CTNNA3     1-0467-005chr10:
69108967-69108967
TCintronicDe novo--Yuen2017 G
CTNNA3     1-0553-003chr10:
68118939-68118941
CTTCintronicDe novo--Yuen2017 G
CTNNA3     7-0024-005chr10:
68920411-68920411
TAintronicDe novo--Yuen2017 G
CTNNA3     AU3052302chr10:
68959441-68959441
TCintronicDe novo--Yuen2017 G
CTNNA3     1-0225-003chr10:
69094781-69094798
TACACACACACACACACATACACACACACACACAintronicDe novo--Yuen2017 G
CTNNA3     AU3874302chr10:
69225140-69225146
AAGAGAGAAGAGintronicDe novo--Yuen2017 G
CTNNA3     1-0806-003chr10:
68259316-68259316
GCintronicDe novo--Yuen2017 G
CTNNA3     EGAN00001101388chr10:
68940119-68940119
TCexonicDe novononsynonymous SNVNM_001127384
NM_013266
NM_001291133
c.A1003G
c.A1003G
c.A1039G
p.I335V
p.I335V
p.I347V
12.068.247E-6Satterstrom2020 E
CTNNA3     1-0985-003chr10:
68155792-68155792
GTintronicDe novo--Yuen2017 G
CTNNA3     1-0286-004chr10:
67927828-67927828
CTintronicDe novo--Yuen2017 G
CTNNA3     13539.p1chr10:
68208612-68208612
TGintronicDe novo--Turner2016 G
CTNNA3     1-0045-004chr10:
67768085-67768085
GCintronicDe novo--Yuen2017 G
CTNNA3     2-0297-004chr10:
68996186-68996186
GTintronicDe novo--Yuen2017 G
CTNNA3     AU2029301chr10:
68130729-68130729
CTintronicDe novo--Yuen2017 G
CTNNA3     AU3725302chr10:
68588173-68588173
TCintronicDe novo--Yuen2017 G
CTNNA3     AU4093302chr10:
67859099-67859099
GTintronicDe novo--Yuen2017 G
CTNNA3     7-0273-003chr10:
68298891-68298891
AGintronicDe novo--Yuen2017 G
CTNNA3     1-0441-003chr10:
68499009-68499009
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA3     2-0319-003chr10:
69507666-69507666
GTintergenicDe novo--Yuen2017 G
CTNNA3     5-0018-003chr10:
67762619-67762619
CTintronicDe novo--Yuen2017 G
CTNNA3     AU4234302chr10:
67810768-67810768
TCintronicDe novo--Yuen2017 G
CTNNA3     A16chr10:
68270835-68270835
TCintronicDe novo--Wu2018 G
CTNNA3     2-1148-004chr10:
68016584-68016584
CTintronicDe novo--Yuen2017 G
CTNNA3     2-1297-003chr10:
68123596-68123596
GAintronicDe novo--Yuen2017 G
CTNNA3     AU047904chr10:
68268291-68268295
CTTTTCTTTintronicDe novo--Yuen2017 G
CTNNA3     5-0014-004chr10:
68302188-68302188
GAintronicDe novo--Yuen2017 G
CTNNA3     AU076509chr10:
69109083-69109083
GAintronicDe novo--Yuen2017 G
CTNNA3     5-0017-004chr10:
67892037-67892037
GAintronicDe novo--Yuen2017 G
CTNNA3     AU057405chr10:
67839149-67839154
TATAATTATintronicDe novo--Yuen2017 G
CTNNA3     AU075703chr10:
67855923-67855923
TAintronicDe novo--Yuen2017 G
CTNNA3     1-0668-003chr10:
69275881-69275881
CTintronicDe novo--Yuen2017 G
CTNNA3     2-1195-003chr10:
67917241-67917255
ATAGATATGTAGATAATAGATAintronicDe novo--Yuen2017 G
CTNNA3     2-1268-003chr10:
68240083-68240083
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA3     3-0482-000chr10:
69047639-69047639
AGintronicDe novo--Yuen2017 G
CTNNA3     AU075207chr10:
68787056-68787056
TCintronicDe novo--Yuen2017 G
CTNNA3     2-1066-004chr10:
69241205-69241205
AGintronicDe novo--Yuen2017 G
CTNNA3     2-0033-003chr10:
69102658-69102658
TAintronicDe novo--Yuen2017 G
CTNNA3     5-0111-003chr10:
68780048-68780048
CTintronicDe novo--Yuen2017 G
CTNNA3     1-0046-003chr10:
67704608-67704615
ATCTGTCTATCTintronicDe novo--Yuen2017 G
CTNNA3     2-0256-004chr10:
67995760-67995760
GAintronicDe novo--Yuen2017 G
CTNNA3     A19chr10:
68513227-68513227
TAintronicDe novo--Wu2018 G
CTNNA3     2-1250-003chr10:
68014792-68014792
CTintronicDe novo--Yuen2017 G
CTNNA3     AU024104chr10:
69147520-69147520
GCintronicDe novo--Yuen2017 G
CTNNA3     2-1306-003chr10:
69316776-69316776
TCintronicDe novo--Yuen2017 G
CTNNA3     1-0330-003chr10:
69015625-69015625
CAintronicDe novo--Yuen2017 G
CTNNA3     AU012804chr10:
68070691-68070691
CTintronicDe novo--Yuen2017 G
CTNNA3     AU038204chr10:
69111318-69111318
TAintronicDe novo--Yuen2017 G
CTNNA3     AU3794301chr10:
68380862-68380862
TCintronicDe novo--Yuen2017 G
CTNNA3     2-1689-003chr10:
68460087-68460087
CTintronicDe novo--Yuen2017 G
CTNNA3     AU030104chr10:
68604063-68604063
CAintronicDe novo--Yuen2017 G
CTNNA3     2-1129-003chr10:
68977444-68977444
ATintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA3     AU4228301chr10:
68881292-68881298
ATGGCTGATGintronicDe novo--Yuen2017 G
CTNNA3     1-0203-004chr10:
68323951-68323951
GAintronicDe novo--Yuen2017 G
CTNNA3     1-0683-003chr10:
68838014-68838021
AAAGACTTAintronicDe novo--Yuen2017 G
CTNNA3     2-0289-004chr10:
69098812-69098817
ATGAATAintronicDe novo--Yuen2017 G
CTNNA3     AU053503chr10:
69344791-69344791
GAintronicDe novo--Yuen2017 G
CTNNA3     14051.p1chr10:
69366755-69366755
CGexonicMosaicnonsynonymous SNVNM_001127384
NM_013266
NM_001291133
c.G152C
c.G152C
c.G188C
p.R51P
p.R51P
p.R63P
25.4-Krupp2017 E
CTNNA3     AU3724301chr10:
69009161-69009161
AGintronicDe novo--Yuen2017 G
CTNNA3     AU3646301chr10:
68321784-68321784
TCintronicDe novo--Yuen2017 G
CTNNA3     2-1105-003chr10:
68585612-68585612
GTintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA3     7-0128-003chr10:
67893179-67893179
AGintronicDe novo--Yuen2017 G
CTNNA3     AU3371302chr10:
67871013-67871013
TCintronicDe novo--Yuen2017 G
CTNNA3     AU4153301chr10:
68486560-68486560
ACintronicDe novo--Yuen2017 G
CTNNA3     AU1795303chr10:
68220662-68220662
CTintronicDe novo--Yuen2017 G
CTNNA3     AU3912303chr10:
69109816-69109816
GAintronicDe novo--Yuen2017 G
CTNNA3     1-0756-003chr10:
68302188-68302188
GAintronicDe novo--Yuen2017 G
CTNNA3     1-0994-003chr10:
69018982-69018982
CAintronicDe novo--Yuen2017 G
CTNNA3     1-0032-003chr10:
69384783-69384783
CGintronicDe novo--Yuen2017 G
CTNNA3     2-1350-004chr10:
68182021-68182021
TCintronicDe novo--Yuen2017 G
CTNNA3     A27chr10:
68550727-68550727
GCintronicDe novo--Wu2018 G
CTNNA3     13829.p1chr10:
68535201-68535201
CAsplicingDe novosplicing23.1-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
CTNNA3     2-0045-003chr10:
68296819-68296819
ACintronicDe novo--Yuen2017 G
CTNNA3     7-0175-003chr10:
68077111-68077111
AGintronicDe novo--Yuen2017 G
CTNNA3     AU4164301chr10:
69284615-69284615
GAintronicDe novo--Yuen2017 G
CTNNA3     AU4463303chr10:
68029548-68029548
AGintronicDe novo--Yuen2017 G
CTNNA3     AU3779304chr10:
67687099-67687099
GAintronicDe novo--Yuen2017 G
CTNNA3     AU024004chr10:
67955739-67955739
CGintronicDe novo--Yuen2017 G
CTNNA3     3-0434-000chr10:
69225278-69225278
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA3     2-0286-003chr10:
68571487-68571487
CTintronicDe novo--Yuen2017 G
CTNNA3     1-0303-004chr10:
68985232-68985232
CAintronicDe novo--Yuen2017 G
CTNNA3     3-0307-000chr10:
67903342-67903342
GAintronicDe novo--Yuen2017 G
CTNNA3     1-0295-003chr10:
68044615-68044615
GAintronicDe novo--Yuen2017 G
CTNNA3     AU030103chr10:
68604063-68604063
CAintronicDe novo--Yuen2017 G
CTNNA3     AU2089301chr10:
68873426-68873426
GAintronicDe novo--Yuen2017 G
CTNNA3     2-0022-004chr10:
69002517-69002517
GAintronicDe novo--Yuen2017 G
CTNNA3     1-0841-003chr10:
68059357-68059357
TAintronicDe novo--Yuen2017 G
CTNNA3     2-1252-003chr10:
68107578-68107578
TCintronicDe novo--Yuen2017 G
CTNNA3     2-1434-003chr10:
69315713-69315713
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CTNNA3     1-0458-005chr10:
69221717-69221717
TGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More