or
or
Exact

Results for "CCDC171"

Variant Events: 49

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CCDC171     7-0250-003chr9:
15655835-15655835
GAintronicDe novo--Yuen2017 G
CCDC171     1-0568-003chr9:
16136791-16136791
GAintergenicDe novo--Yuen2017 G
CCDC171     AU031004chr9:
15867915-15867915
CGintronicDe novo--Yuen2017 G
CCDC171     AU073006chr9:
15745580-15745580
TCexonicDe novosynonymous SNVNM_173550c.T2622Cp.A874A7.227-Yuen2017 G
CCDC171     74-0117chr9:
15930798-15930798
AGintronicDe novo--Michaelson2012 G
CCDC171     AU1795302chr9:
15652097-15652097
GTintronicDe novo--Yuen2017 G
CCDC171     1-0708-003chr9:
15962200-15962200
TCintronicDe novo--Yuen2017 G
CCDC171     Lim2017:37418chr9:
15784693-15784693
GAsplicingDe novosplicing19.64-Lim2017 E
CCDC171     7-0215-003chr9:
15881327-15881337
TTTTTCTCATTTTTintronicDe novo--Yuen2017 G
CCDC171     1-0673-003chr9:
16174356-16174356
CTintergenicDe novo--Yuen2017 G
CCDC171     AU036203chr9:
15902987-15902987
CTintronicDe novo--Yuen2017 G
CCDC171     1-0246-004chr9:
15936551-15936551
CAintronicDe novo--Yuen2017 G
CCDC171     2-1366-004chr9:
15648652-15648652
ATintronicDe novo--Yuen2017 G
CCDC171     AU1764301chr9:
15805158-15805158
GAintronicDe novo--Yuen2017 G
CCDC171     AU034904chr9:
16012263-16012263
ATintergenicDe novo--Yuen2017 G
CCDC171     AU3765303chr9:
16185317-16185317
ACintergenicDe novo--Yuen2017 G
CCDC171     1-0339-003chr9:
15998310-15998310
TGintergenicDe novo--Yuen2017 G
CCDC171     iHART2343chr9:
15623382-15623382
CTexonicMaternalstopgainNM_173550c.C793Tp.R265X40.08.278E-5Ruzzo2019 G
CCDC171     iHART2516chr9:
15623349-15623349
CTexonicMaternalstopgainNM_173550c.C760Tp.R254X40.03.0E-4Ruzzo2019 G
CCDC171     2-1220-003chr9:
16109822-16109836
GTATATATATATATAGTATATATATATAintergenicDe novo--Yuen2017 G
CCDC171     iHART1891chr9:
15724780-15724780
CTexonicPaternalstopgainNM_173550c.C1498Tp.Q500X42.03.312E-5Ruzzo2019 G
CCDC171     2-0182-003chr9:
16062570-16062570
ATintergenicDe novo--Yuen2017 G
CCDC171     2-1356-003chr9:
16041108-16041108
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
CCDC171     AU4186302chr9:
15891217-15891217
GTintronicDe novo--Yuen2017 G
CCDC171     AU058103chr9:
15698759-15698759
CTintronicDe novo--Yuen2017 G
CCDC171     AU4243302chr9:
15755438-15755438
AGintronicDe novo--Yuen2017 G
CCDC171     2-1475-003chr9:
16134725-16134725
AGintergenicDe novo--Yuen2017 G
CCDC171     14575.p1chr9:
15784693-15784693
GAsplicingDe novosplicing19.64-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
CCDC171     3-0436-000chr9:
16055052-16055052
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
CCDC171     AU011704chr9:
15930798-15930798
AGintronicDe novo--Yuen2017 G
CCDC171     13964.p1chr9:
15767844-15767844
TCintronicDe novo--Turner2016 G
CCDC171     13515.p1chr9:
15941025-15941025
CTintronicDe novo--Turner2016 G
CCDC171     14370.p1chr9:
15728490-15728490
AGintronicDe novo--Turner2016 G
CCDC171     11194.p1chr9:
16100347-16100347
TCintergenicDe novo--Turner2016 G
CCDC171     AU3053302chr9:
15633462-15633462
TCintronicDe novo--Yuen2017 G
CCDC171     13515.p1chr9:
16105526-16105526
GAintergenicDe novo--Turner2016 G
CCDC171     1-0973-003chr9:
15730846-15730846
AGintronicDe novo--Yuen2017 G
CCDC171     AU3861303chr9:
15934788-15934788
AGintronicDe novo--Yuen2017 G
CCDC171     1-0393-003chr9:
16052544-16052544
GAintergenicDe novo--Yuen2017 G
CCDC171     AU4103301chr9:
16102283-16102283
GAintergenicDe novo--Yuen2017 G
CCDC171     2-0244-004chr9:
15915045-15915045
GTintronicDe novo--Yuen2017 G
CCDC171     7-0130-003chr9:
16098731-16098731
CAintergenicDe novo--Yuen2017 G
CCDC171     1-0744-003chr9:
16110328-16110328
GAintergenicDe novo--Yuen2017 G
CCDC171     2-1368-003chr9:
15636152-15636167
GTATATATATATATATGTATATATATATATintronicDe novo--Yuen2017 G
CCDC171     AU2951303chr9:
15566461-15566461
GCintronicDe novo--Yuen2017 G
CCDC171     3-0216-000chr9:
15599654-15599654
TCintronicDe novo--Yuen2017 G
CCDC171     1-0806-003chr9:
15708799-15708799
CTintronicDe novo--Yuen2017 G
CCDC171     AU1635302chr9:
16192175-16192175
CTintergenicDe novo--Yuen2017 G
CCDC171     AU2951302chr9:
15566461-15566461
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More