or
or
Exact

Results for "ELAVL2"

Variant Events: 56

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ELAVL2     2-1619-004chr9:
24428429-24428429
AGintergenicDe novo--Yuen2017 G
ELAVL2     7-0140-003chr9:
24184243-24184243
GAintergenicDe novo--Yuen2017 G
ELAVL2     3-0065-000chr9:
23793213-23793213
TCintronicDe novo--Yuen2017 G
ELAVL2     1-0141-003chr9:
24483873-24483873
ATintergenicDe novo--Yuen2017 G
ELAVL2     AU2485305chr9:
23698762-23698762
GAintronicDe novo--Yuen2017 G
ELAVL2     7-0174-003chr9:
24000629-24000629
GAintergenicDe novo--Yuen2017 G
ELAVL2     1-0906-003chr9:
23760097-23760097
TCintronicDe novo--Yuen2017 G
ELAVL2     1-0272-003chr9:
23734024-23734024
AATGAGintronicDe novo--Yuen2017 G
ELAVL2     AU4056301chr9:
24019760-24019760
TCintergenicDe novo--Yuen2017 G
ELAVL2     AU4056301chr9:
24336689-24336689
AGintergenicDe novo--Yuen2017 G
ELAVL2     AU3885305chr9:
24391835-24391835
CTintergenicDe novo--Yuen2017 G
ELAVL2     2-1451-003chr9:
23891866-23891866
AGintergenicDe novo--Yuen2017 G
ELAVL2     1-0990-003chr9:
24151253-24151253
CTintergenicDe novo--Yuen2017 G
ELAVL2     AU2156303chr9:
23816452-23816452
AGintronicDe novo--Yuen2017 G
ELAVL2     3-0482-000chr9:
24242901-24242901
GAintergenicDe novo--Yuen2017 G
ELAVL2     2-1174-006chr9:
23936737-23936737
CTintergenicDe novo--Yuen2017 G
ELAVL2     1-0551-004chr9:
24380305-24380305
TAintergenicDe novo--Yuen2017 G
ELAVL2     AU1355301chr9:
24005706-24005706
CTintergenicDe novo--Yuen2017 G
ELAVL2     AU3790301chr9:
24052129-24052129
TCintergenicDe novo--Yuen2017 G
ELAVL2     3-0140-000chr9:
24180059-24180059
GAintergenicDe novo--Yuen2017 G
ELAVL2     2-1177-003chr9:
23935847-23935848
ATAintergenicDe novo--Yuen2016 G
Yuen2017 G
ELAVL2     7-0191-003chr9:
24134036-24134036
GAintergenicDe novo--Yuen2017 G
ELAVL2     7-0179-003chr9:
24001116-24001130
GGTGTGTGTGTGTGTGGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
ELAVL2     AU003405chr9:
24523194-24523194
GCintergenicDe novo--Yuen2017 G
ELAVL2     AU2777302chr9:
23922734-23922734
GAintergenicDe novo--Yuen2017 G
ELAVL2     1-0534-006chr9:
23818966-23818966
AGintronicDe novo--Yuen2017 G
ELAVL2     1-0271-003chr9:
23876269-23876269
GGTAGTATTCCAGGGTTTGTintergenicDe novo--Yuen2017 G
ELAVL2     2-1475-003chr9:
23723147-23723147
TCintronicDe novo--Yuen2017 G
ELAVL2     7-0197-003chr9:
24338839-24338839
CTintergenicDe novo--Yuen2017 G
ELAVL2     14248.p1chr9:
23692707-23692714
CACGGATGCexonicDe novoframeshift deletionNM_001171195
NM_001171197
NM_004432
c.882_888del
c.882_888del
c.921_927del
p.V294fs
p.V294fs
p.V307fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
ELAVL2     1-0896-003chr9:
24521972-24521972
CTintergenicDe novo--Yuen2017 G
ELAVL2     AU4093301chr9:
23904441-23904451
AGTCCCCTTGTAGTintergenicDe novo--Yuen2017 G
ELAVL2     7-0141-003chr9:
24403288-24403288
GAintergenicDe novo--Yuen2017 G
ELAVL2     AU4410302chr9:
23862537-23862537
GAintergenicDe novo--Yuen2017 G
ELAVL2     AU0638302chr9:
24495264-24495264
AGintergenicDe novo--Yuen2017 G
ELAVL2     AU4033304chr9:
24353253-24353253
GAintergenicDe novo--Yuen2017 G
ELAVL2     7-0247-003chr9:
23724096-23724096
CTintronicDe novo--Yuen2017 G
ELAVL2     1-0994-003chr9:
24001116-24001130
GGTGTGTGTGTGTGTGGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
ELAVL2     2-1456-003chr9:
24238267-24238271
ATAGTAintergenicDe novo--Yuen2017 G
ELAVL2     2-1629-003chr9:
23943576-23943576
GAintergenicDe novo--Yuen2017 G
ELAVL2     1-0142-005chr9:
24522411-24522411
AGintergenicDe novo--Yuen2017 G
ELAVL2     AU4269301chr9:
24019005-24019005
CAintergenicDe novo--Yuen2017 G
ELAVL2     AU012803chr9:
24252276-24252276
TGintergenicDe novo--Yuen2017 G
ELAVL2     1-0272-004chr9:
23734024-23734024
AATGAGintronicDe novo--Yuen2017 G
ELAVL2     2-1702-004chr9:
24198249-24198249
GTintergenicDe novo--Yuen2017 G
ELAVL2     AU2427301chr9:
24490699-24490699
TCintergenicDe novo--Yuen2017 G
ELAVL2     2-1357-004chr9:
24201915-24201915
GAintergenicDe novo--Yuen2017 G
ELAVL2     1-0582-003chr9:
24010990-24010990
CAintergenicDe novo--Yuen2017 G
ELAVL2     2-0129-005chr9:
23769726-23769726
GAintronicDe novo--Yuen2017 G
ELAVL2     AU1987304chr9:
24283400-24283400
ATintergenicDe novo--Yuen2017 G
ELAVL2     AU4060306chr9:
24503768-24503768
CTintergenicDe novo--Yuen2017 G
ELAVL2     2-1529-003chr9:
24502928-24502928
TAintergenicDe novo--Yuen2017 G
ELAVL2     AU072505chr9:
24186065-24186065
AGintergenicDe novo--Yuen2017 G
ELAVL2     7-0103-003chr9:
23825503-23825503
TGintronicDe novo--Yuen2017 G
ELAVL2     2-1129-003chr9:
24239130-24239130
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ELAVL2     AU072504chr9:
23874120-23874120
CGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More