or
or
Exact

Results for "DPP6"

Variant Events: 69

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DPP6     2-0272-003chr7:
154473307-154473307
CCGintronicDe novo--Yuen2017 G
DPP6     3-0458-000Bchr7:
153844793-153844806
CTATATATATATATCTATATATATATintronicDe novo--Yuen2017 G
DPP6     AU4159302chr7:
154089379-154089379
GAintronicDe novo--Yuen2017 G
DPP6     AU2485305chr7:
153980163-153980163
TGintronicDe novo--Yuen2017 G
DPP6     12175.p1chr7:
154462585-154462585
CTintronicDe novo--Turner2016 G
DPP6     1-0998-003chr7:
153983648-153983657
AATTTTAATGAATTTTAATGATTTTAATGintronicDe novo--Yuen2017 G
DPP6     2-0285-004chr7:
154692914-154692914
GAintergenicDe novo--Yuen2017 G
DPP6     2-1635-004chr7:
153950769-153950772
GATAGintronicDe novo--Yuen2017 G
DPP6     AU3885305chr7:
154610144-154610144
CTintronicDe novo--Yuen2017 G
DPP6     1-0153-004chr7:
154577371-154577371
TAintronicDe novo--Yuen2017 G
DPP6     AU4028302chr7:
153758309-153758309
GCintronicDe novo--Yuen2017 G
DPP6     AU4028302chr7:
153758525-153758525
CGintronicDe novo--Yuen2017 G
DPP6     2-0043-003chr7:
153873847-153873847
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DPP6     AU3712302chr7:
154405482-154405482
TAintronicDe novo--Yuen2017 G
DPP6     AU3648301chr7:
154150128-154150128
AGintronicDe novo--Yuen2017 G
DPP6     AU3857301chr7:
154504455-154504455
CAintronicDe novo--Yuen2017 G
DPP6     2-1526-003chr7:
154688598-154688598
TGintergenicDe novo--Yuen2017 G
DPP6     AU076509chr7:
153926277-153926277
GTintronicDe novo--Yuen2017 G
DPP6     AU3371301chr7:
154702865-154702865
GAintergenicDe novo--Yuen2017 G
DPP6     1-0627-007chr7:
154179220-154179220
GTintronicDe novo--Yuen2017 G
DPP6     1-0826-003chr7:
154032415-154032415
CCAAAATintronicDe novo--Yuen2017 G
DPP6     AU2139305chr7:
153956247-153956247
AGintronicDe novo--Yuen2017 G
DPP6     AU2108302chr7:
153739032-153739032
CTintronicDe novo--Yuen2017 G
DPP6     SP0043850chr7:
154585859-154585859
CTexonicDe novostopgainNM_001290252
NM_001039350
NM_001936
NM_130797
c.C886T
c.C1015T
c.C1021T
c.C1207T
p.Q296X
p.Q339X
p.Q341X
p.Q403X
39.0-Feliciano2019 E
DPP6     3-0458-000Achr7:
153844793-153844806
CTATATATATATATCTATATATATATintronicDe novo--Yuen2017 G
DPP6     2-1195-003chr7:
153844871-153844871
CTintronicDe novo--Yuen2017 G
DPP6     2-1348-003chr7:
154613417-154613417
TCintronicDe novo--Yuen2017 G
DPP6     AU1355301chr7:
153708556-153708562
CAAAAAACAAAAAAAintronicDe novo--Yuen2017 G
DPP6     2-1296-003chr7:
154508432-154508432
GCintronicDe novo--Yuen2017 G
DPP6     iHART2027chr7:
154664403-154664407
TGTAATsplicingPaternalsplicing--Ruzzo2019 G
DPP6     1-0336-003chr7:
153935124-153935124
TGintronicDe novo--Yuen2017 G
DPP6     iHART2032chr7:
153584813-153584823
CGTGATGGTGACexonicPaternalnonframeshift deletionNM_001039350c.46_51delp.16_17del--Ruzzo2019 G
DPP6     AU4186302chr7:
154445068-154445069
TATintronicDe novo--Yuen2017 G
DPP6     AU4359301chr7:
154659843-154659843
AGintronicDe novo--Yuen2017 G
DPP6     1-0330-003chr7:
154495928-154495928
GCintronicDe novo--Yuen2017 G
DPP6     AU3175302chr7:
154458687-154458687
AGintronicDe novo--Yuen2017 G
DPP6     AU3790301chr7:
154554950-154554950
GAintronicDe novo--Yuen2017 G
DPP6     2-1315-003chr7:
153880217-153880217
CGintronicDe novo--Yuen2016 G
Yuen2017 G
DPP6     AU2029303chr7:
154589577-154589577
AGintronicDe novo--Yuen2017 G
DPP6     AU1909304chr7:
153975980-153975988
ATGTGTGTGATGTGTGintronicDe novo--Yuen2017 G
DPP6     1-0912-003chr7:
153895576-153895576
CTintronicDe novo--Yuen2017 G
DPP6     2-0272-004chr7:
154470475-154470475
AGintronicDe novo--Yuen2017 G
DPP6     AU005213chr7:
153595379-153595379
ACintronicDe novo--Yuen2017 G
DPP6     2-1085-004chr7:
154182479-154182479
GAintronicDe novo--Yuen2017 G
DPP6     14523.p1chr7:
154561183-154561183
GAexonicDe novononsynonymous SNVNM_001290252
NM_001039350
NM_001936
NM_130797
c.G619A
c.G748A
c.G754A
c.G940A
p.A207T
p.A250T
p.A252T
p.A314T
22.23.314E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
DPP6     13906.p1chr7:
154681252-154681252
AGintronicDe novo-1.422E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
DPP6     A19chr7:
154640012-154640012
GAintronicDe novo--Wu2018 G
DPP6     7-0077-003chr7:
153802240-153802240
GAintronicDe novo--Yuen2017 G
DPP6     2-0145-003chr7:
153867584-153867584
CCCCCAintronicDe novo--Yuen2017 G
DPP6     2-0238-004chr7:
154007966-154007966
GTintronicDe novo--Yuen2017 G
DPP6     AU024608chr7:
154389002-154389002
AGintronicDe novo--Yuen2017 G
DPP6     1-0609-003chr7:
154638343-154638343
GAintronicDe novo--Yuen2017 G
DPP6     5-0004-003chr7:
153981280-153981280
CTintronicDe novo--Yuen2017 G
DPP6     2-1166-003chr7:
154137954-154137954
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DPP6     AU4033304chr7:
154503790-154503790
AGintronicDe novo--Yuen2017 G
DPP6     2-0122-003chr7:
154593766-154593766
CTintronicDe novo--Yuen2017 G
DPP6     AU2029302chr7:
154589577-154589577
AGintronicDe novo--Yuen2017 G
DPP6     2-0244-004chr7:
154218330-154218330
TCintronicDe novo--Yuen2017 G
DPP6     AU3955303chr7:
154477359-154477359
GAintronicDe novo--Yuen2017 G
DPP6     1-0345-003chr7:
154391998-154391998
CTintronicDe novo--Yuen2017 G
DPP6     1-0606-003chr7:
154253702-154253702
ATintronicDe novo--Yuen2017 G
DPP6     AU2381302chr7:
153999693-153999693
CTintronicDe novo--Yuen2017 G
DPP6     AU2072302chr7:
154518376-154518376
TCintronicDe novo--Yuen2017 G
DPP6     1-0232-004chr7:
154625702-154625702
CTintronicDe novo--Yuen2017 G
DPP6     2-1290-004chr7:
153639806-153639806
AGintronicDe novo--Yuen2017 G
DPP6     1-0346-004chr7:
154414400-154414400
GAintronicDe novo--Yuen2017 G
DPP6     AU3911301chr7:
153705741-153705744
TTCTTTintronicDe novo--Yuen2017 G
DPP6     2-1280-003chr7:
153939485-153939485
AGintronicDe novo--Yuen2017 G
DPP6     5-0148-003chr7:
154645526-154645526
CTexonicDe novononsynonymous SNVNM_001290252
NM_001039350
NM_001936
NM_130797
c.C1382T
c.C1511T
c.C1517T
c.C1703T
p.T461I
p.T504I
p.T506I
p.T568I
5.256-Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More