or
or
Exact

Results for "IDO2"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
IDO2     AU1933301chr8:
39976461-39976461
CGintergenicDe novo--Yuen2017 G
IDO2     2-0305-004chr8:
39893941-39893941
TAintergenicDe novo--Yuen2017 G
IDO2     1-0834-003chr8:
39963021-39963021
GAintergenicDe novo--Yuen2017 G
IDO2     13023.p1chr8:
39997312-39997312
TCintergenicDe novo--Turner2016 G
IDO2     13204.p1chr8:
39872850-39872850
GAexonicDe novononsynonymous SNVNM_194294c.G992Ap.R331K10.72-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
IDO2     AU3955303chr8:
39856326-39856333
ATTTTTTTATTTTTTintronicDe novo--Yuen2017 G
IDO2     2-1459-003chr8:
39846958-39846958
GAintronicDe novo--Yuen2017 G
IDO2     7-0251-003chr8:
39922275-39922298
TCAAAACAAAACAAAACAAAACAATCAAAACAAAACAAAACAAintergenicDe novo--Yuen2017 G
IDO2     AU049304chr8:
39831611-39831611
GAintronicDe novo--Yuen2017 G
IDO2     1-0604-003chr8:
39804795-39804795
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More