or
or
Exact

Results for "DAPK1"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DAPK1     00HI1751Achr9:
90318054-90318054
CTexonicDe novosynonymous SNVNM_001288729
NM_001288730
NM_001288731
NM_004938
c.C2982T
c.C2982T
c.C2982T
c.C2982T
p.D994D
p.D994D
p.D994D
p.D994D
--Satterstrom2020 E
DAPK1     AU3790301chr9:
90120562-90120562
GAintronicDe novo--Yuen2017 G
DAPK1     A15chr9:
90334123-90334123
AGintergenicDe novo--Wu2018 G
DAPK1     2-1525-003chr9:
90217466-90217466
CTintronicDe novo--Yuen2017 G
DAPK1     AU047904chr9:
90245500-90245500
GAintronicDe novo--Yuen2017 G
DAPK1     09C99931chr9:
90301541-90301541
CTexonicDe novononsynonymous SNVNM_001288729
NM_001288730
NM_001288731
NM_004938
c.C2300T
c.C2300T
c.C2300T
c.C2300T
p.P767L
p.P767L
p.P767L
p.P767L
28.3-Satterstrom2020 E
DAPK1     13884.p1chr9:
90264933-90264933
GAexonicDe novononsynonymous SNVNM_001288729
NM_001288730
NM_001288731
NM_004938
c.G1526A
c.G1526A
c.G1526A
c.G1526A
p.R509Q
p.R509Q
p.R509Q
p.R509Q
19.912.485E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
DAPK1     1-0024-003chr9:
90301541-90301541
CTexonicDe novononsynonymous SNVNM_001288729
NM_001288730
NM_001288731
NM_004938
c.C2300T
c.C2300T
c.C2300T
c.C2300T
p.P767L
p.P767L
p.P767L
p.P767L
28.3-Yuen2016 G
Yuen2017 G
DAPK1     1-0007-003chr9:
90328368-90328382
CGTGTGTGTGTGTGTCGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
DAPK1     AU3903301chr9:
90267687-90267687
GAintronicDe novo--Yuen2017 G
DAPK1     11414.p1chr9:
90263666-90263666
TCintronicDe novo--Satterstrom2020 E
DAPK1     1-0215-006chr9:
90256810-90256810
TCintronicDe novo--Yuen2017 G
DAPK1     AU3635301chr9:
90301768-90301768
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More