or
or
Exact

Results for "PRUNE2"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PRUNE2     AC02-1240-01chr9:
79325023-79325023
GAexonicDe novononsynonymous SNVNM_001308047
NM_001308048
NM_015225
c.C2167T
c.C2167T
c.C2167T
p.P723S
p.P723S
p.P723S
0.018-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
PRUNE2     2-1120-003chr9:
79345539-79345539
CTintronicDe novo--Yuen2017 G
PRUNE2     F2-003chr9:
79324017-79324017
TCexonicPaternalnonsynonymous SNVNM_001308047
NM_001308048
NM_015225
c.A3173G
c.A3173G
c.A3173G
p.E1058G
p.E1058G
p.E1058G
17.52-Vaags2012 E
PRUNE2     1-0261-003chr9:
79568141-79568141
TCintergenicDe novo--Yuen2017 G
PRUNE2     PN400313chr9:
79259691-79259691
CAexonicUnknownnonsynonymous SNVNM_001308050
NM_001308051
NM_001308049
NM_001308047
NM_001308048
NM_015225
c.G484T
c.G487T
c.G439T
c.G8692T
c.G8695T
c.G8692T
p.V162F
p.V163F
p.V147F
p.V2898F
p.V2899F
p.V2898F
24.13.0E-4Leblond2019 E
PRUNE2     2-0070-003chr9:
79610557-79610557
TCintergenicDe novo--Yuen2017 G
PRUNE2     1-0513-003chr9:
79615605-79615605
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
PRUNE2     1-0019-004chr9:
79585281-79585281
CTintergenicDe novo--Yuen2017 G
PRUNE2     1-0065-005chr9:
79570775-79570775
CTintergenicDe novo--Yuen2017 G
PRUNE2     2-1407-003chr9:
79315431-79315431
CAintronicDe novo--Yuen2016 G
Yuen2017 G
PRUNE2     iHART1921chr9:
79465539-79465539
GGTexonicPaternalframeshift insertionNM_001308047
NM_001308048
NM_015225
c.183dupA
c.183dupA
c.183dupA
p.P62fs
p.P62fs
p.P62fs
-8.245E-6Ruzzo2019 G
PRUNE2     iHART1378chr9:
79328485-79328485
GTexonicPaternalstopgainNM_001308047
NM_001308048
NM_015225
c.C909A
c.C909A
c.C909A
p.C303X
p.C303X
p.C303X
38.0-Ruzzo2019 G
PRUNE2     iHART1731chr9:
79322101-79322103
ACTAexonicPaternalframeshift deletionNM_001308047
NM_001308048
NM_015225
c.5087_5088del
c.5087_5088del
c.5087_5088del
p.E1696fs
p.E1696fs
p.E1696fs
--Ruzzo2019 G
PRUNE2     2-1167-003chr9:
79375359-79375359
CGintronicDe novo--Yuen2016 G
Yuen2017 G
PRUNE2     2-1290-003chr9:
79612893-79612893
TTTAAAAGAAAAAAATAAATTTAAAAAAAAAAAATAAATAAAAintergenicDe novo--Yuen2017 G
PRUNE2     CC1121.201chr9:
79328687-79328687
GAintronicDe novo-2.941E-5Satterstrom2020 E
PRUNE2     PN400205chr9:
79441589-79441589
CAexonicUnknownstopgainNM_001308047
NM_001308048
NM_015225
c.G568T
c.G568T
c.G568T
p.E190X
p.E190X
p.E190X
35.0-Leblond2019 E
PRUNE2     14383.p1chr9:
79323453-79323453
CTexonicDe novononsynonymous SNVNM_001308047
NM_001308048
NM_015225
c.G3737A
c.G3737A
c.G3737A
p.R1246K
p.R1246K
p.R1246K
12.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
PRUNE2     1-0640-003chr9:
79445060-79445060
GAintronicDe novo--Yuen2017 G
PRUNE2     Cukier2014:7590chr9:
79465455-79465455
CTexonicUnknownnonsynonymous SNVNM_001308047
NM_001308048
NM_015225
c.G268A
c.G268A
c.G268A
p.D90N
p.D90N
p.D90N
27.80.0093Cukier2014 E
PRUNE2     NDAR_INVWV443KNU_wes1chr9:
79520812-79520812
CGintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
PRUNE2     1-0025-006chr9:
79571115-79571115
TTTCCCTCCAintergenicDe novo--Yuen2017 G
PRUNE2     5-0050-003chr9:
79495868-79495868
CAintronicDe novo--Yuen2017 G
PRUNE2     AU049304chr9:
79285760-79285760
CGintronicDe novo--Yuen2017 G
PRUNE2     SP0000691chr9:
79267586-79267586
ACexonicDe novosynonymous SNVNM_001308050
NM_001308051
NM_001308049
NM_001308047
NM_001308048
NM_015225
c.T162G
c.T162G
c.T117G
c.T8370G
c.T8370G
c.T8370G
p.S54S
p.S54S
p.S39S
p.S2790S
p.S2790S
p.S2790S
10.47-Feliciano2019 E
PRUNE2     2-0081-003chr9:
79546148-79546148
CTintergenicDe novo--Yuen2017 G
PRUNE2     1-0225-003chr9:
79574091-79574118
GTATATATATATATGTATATATATATATGTATATATATATGTATATATATATATintergenicDe novo--Yuen2017 G
PRUNE2     AU3951301chr9:
79535292-79535292
GAintergenicDe novo--Yuen2017 G
PRUNE2     PN400115chr9:
79465455-79465455
CTexonicUnknownnonsynonymous SNVNM_001308047
NM_001308048
NM_015225
c.G268A
c.G268A
c.G268A
p.D90N
p.D90N
p.D90N
27.80.0093Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More