or
or
Exact

Results for "CALN1"

Variant Events: 105

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CALN1     2-1355-004chr7:
71525325-71525325
TCintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0286-004chr7:
71907817-71907817
GGCACTTTATGTAGGGTTGCAintergenicDe novo--Trost2022 G
Yuen2017 G
CALN1     2-0319-003chr7:
71605400-71605400
CAintronicDe novo--Yuen2017 G
CALN1     2-1305-003chr7:
71562061-71562061
GAintronicDe novo--Yuen2017 G
CALN1     1-0465-003achr7:
71625643-71625643
TCintronicDe novo--Yuen2017 G
CALN1     AU030703chr7:
71628930-71628944
GAAGAAAGAAAGAAAGAAGAAAGAAAintronicDe novo--Yuen2017 G
CALN1     3-0169-000chr7:
71588127-71588127
CTintronicDe novo--Yuen2016 G
CALN1     1-0150-004chr7:
71380383-71380383
ACintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     2-1308-003chr7:
71773550-71773550
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CALN1     1-0567-003chr7:
71319276-71319276
CTintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0025-006chr7:
71673946-71673946
CAintronicDe novo, Paternal--Trost2022 G
Yuen2017 G
CALN1     mAGRE2999chr7:
71868249-71868249
CCGGexonicMaternalframeshift insertionNM_031468c.105_106insCCp.D36fs--Cirnigliaro2023 G
CALN1     5-0138-003chr7:
71731769-71731769
GAintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0901-004chr7:
71626582-71626582
TCintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0160-004chr7:
71839612-71839612
CTintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     2-1288-003chr7:
71394972-71394972
GAintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     2-1509-003chr7:
71853685-71853700
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
CALN1     2-1265-003chr7:
71630869-71630869
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CALN1     2-1721-003chr7:
71312372-71312372
CTintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0388-003chr7:
72008554-72008554
CTintergenicDe novo--Yuen2017 G
CALN1     1-0433-004chr7:
71329754-71329754
ACintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     SP0041462chr7:
71488635-71488635
TCintronicDe novo--Trost2022 G
Zhou2022 GE
CALN1     2-1277-004chr7:
71318709-71318710
TGGGCCintronicDe novo--Trost2022 G
CALN1     3-0436-000chr7:
71374017-71374017
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CALN1     2-1277-004chr7:
71318713-71318714
TGCCintronicDe novo--Trost2022 G
CALN1     AU4410302chr7:
71786418-71786418
CAintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     7-0150-003chr7:
71312456-71312458
GAAGintronicDe novo--Trost2022 G
CALN1     1-1010-003chr7:
71315063-71315063
GAintronicDe novo--Trost2022 G
CALN1     4-0074-003chr7:
71299181-71299181
TCintronicDe novo--Trost2022 G
CALN1     P6Q4Z_01chr7:
71305490-71305490
AGintronicDe novo--Trost2022 G
CALN1     4-0108-003chr7:
71254579-71254579
CTintronicDe novo--Trost2022 G
CALN1     MSSNG00410-003chr7:
71438543-71438543
CTintronicDe novo--Trost2022 G
CALN1     AU2729301chr7:
71449377-71449377
CTintronicDe novo--Trost2022 G
CALN1     MT_167.3chr7:
71380498-71380498
CTintronicDe novo--Trost2022 G
CALN1     AU0636303chr7:
71436966-71436966
GAintronicDe novo--Trost2022 G
CALN1     MSSNG00399-003chr7:
71330725-71330725
GTintronicDe novo--Trost2022 G
CALN1     MSSNG00196-003chr7:
71331653-71331653
GCintronicDe novo--Trost2022 G
CALN1     2-1277-004chr7:
71318720-71318722
ACAGCTintronicDe novo--Trost2022 G
CALN1     2-1277-004chr7:
71318730-71318733
AATTCAGCintronicDe novo--Trost2022 G
CALN1     7-0335-003chr7:
71554757-71554757
AGintronicDe novo--Trost2022 G
CALN1     REACH000141chr7:
71576753-71576753
GAintronicDe novo--Trost2022 G
CALN1     2-1169-004chr7:
71524966-71524966
TTACCACCAAintronicDe novo--Trost2022 G
CALN1     7-0402-003chr7:
71527221-71527221
TAintronicDe novo--Trost2022 G
CALN1     REACH000171chr7:
71503062-71503062
TCintronicDe novo--Trost2022 G
CALN1     14143.p1chr7:
71252912-71252912
GAintronicDe novo--Satterstrom2020 E
Trost2022 G
CALN1     MSSNG00227-003chr7:
71520274-71520274
CAintronicDe novo--Trost2022 G
CALN1     2-1644-003chr7:
71866925-71866925
TCintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     AU3053302chr7:
71810016-71810018
CATCintronicDe novo--Yuen2017 G
CALN1     3-0352-000chr7:
71478013-71478013
CTintronicDe novo--Trost2022 G
CALN1     1-1197-003chr7:
71498597-71498597
GCintronicDe novo--Trost2022 G
CALN1     2-0309-005chr7:
71605403-71605403
ACintronicDe novo--Trost2022 G
CALN1     2-0210-005chr7:
71605403-71605403
ACintronicDe novo--Trost2022 G
CALN1     2-0309-005chr7:
71605400-71605400
CAintronicDe novo--Trost2022 G
CALN1     2-0210-005chr7:
71605400-71605400
CAintronicDe novo--Trost2022 G
CALN1     AU1542301chr7:
71557416-71557416
CTintronicDe novo--Yuen2017 G
CALN1     1-0887-003chr7:
71601051-71601051
CTintronicDe novo--Trost2022 G
CALN1     3-0439-000chr7:
71657040-71657040
CTintronicDe novo--Yuen2016 G
CALN1     1-0887-003chr7:
71601600-71601600
GTintronicDe novo--Trost2022 G
CALN1     AU2288301chr7:
71577059-71577059
TGintronicDe novo--Trost2022 G
CALN1     2-1397-003chr7:
71997022-71997022
CTintergenicDe novo--Yuen2017 G
CALN1     1-1103-003chr7:
71588510-71588510
CAintronicDe novo--Trost2022 G
CALN1     2-1762-003chr7:
71727219-71727219
GAintronicDe novo--Trost2022 G
CALN1     MSSNG00352-003chr7:
71738227-71738227
GAintronicDe novo--Trost2022 G
CALN1     1-1129-003chr7:
71716018-71716018
TCintronicDe novo--Trost2022 G
CALN1     REACH000435chr7:
71719736-71719740
CATAACintronicDe novo--Trost2022 G
CALN1     SJD_3.3chr7:
71660924-71660924
ACintronicDe novo--Trost2022 G
CALN1     MSSNG00043-003chr7:
71673572-71673572
TCintronicDe novo--Trost2022 G
CALN1     5-2015-003chr7:
71607302-71607302
GCintronicDe novo--Trost2022 G
CALN1     1-0465-003Achr7:
71625643-71625643
TCintronicDe novo--Trost2022 G
CALN1     7-0240-003chr7:
71805722-71805722
TCintronicDe novo--Trost2022 G
CALN1     AU4092302chr7:
71701835-71701835
TCintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     MSSNG00434-003chr7:
71806868-71806868
AGintronicDe novo--Trost2022 G
CALN1     2-1749-003chr7:
71786486-71786486
GAintronicDe novo--Trost2022 G
CALN1     AU2216201chr7:
71801373-71801373
GTintronicDe novo--Trost2022 G
CALN1     5-5022-003chr7:
71768402-71768402
CTintronicDe novo--Trost2022 G
CALN1     1-0611-003chr7:
71769669-71769669
GAintronicDe novo--Trost2022 G
CALN1     7-0365-003chr7:
71749650-71749650
ACintronicDe novo--Trost2022 G
CALN1     REACH000089chr7:
71757831-71757831
TAintronicDe novo--Trost2022 G
CALN1     MSSNG00031-003chr7:
71898738-71898738
TCintergenicDe novo--Trost2022 G
CALN1     AU0452304chr7:
71764275-71764275
ATintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0287-003chr7:
71872554-71872554
TGintronicDe novo--Trost2022 G
CALN1     7-0423-003chr7:
71890390-71890390
CTintergenicDe novo--Trost2022 G
CALN1     2-1174-005Bchr7:
71845437-71845437
GAintronicDe novo--Trost2022 G
CALN1     3-0371-000chr7:
71862982-71862982
GAintronicDe novo--Trost2022 G
CALN1     2-1466-003chr7:
71891240-71891240
AGintergenicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CALN1     7-0314-003Achr7:
71823435-71823435
CTintronicDe novo--Trost2022 G
CALN1     1-0627-007chr7:
71826891-71826891
CAintronicDe novo--Trost2022 G
CALN1     2-1105-003chr7:
72028734-72028734
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
CALN1     2-1510-003chr7:
71309600-71309600
GAintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     14590.p1chr7:
71343977-71343977
CTintronicDe novo--Turner2016 G
CALN1     AU3713302chr7:
71777248-71777248
GTintronicDe novo--Yuen2017 G
CALN1     7-0179-003chr7:
71403851-71403851
ATintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0465-003chr7:
71625643-71625643
TCintronicDe novo--Yuen2017 G
CALN1     AC02-1197-01chr7:
71488801-71488801
ACintronicDe novo-0.0038Kosmicki2017 E
CALN1     2-0003-003chr7:
71674023-71674023
CCCTintronicDe novo--Yuen2017 G
CALN1     ASC_CA_58_Achr7:
71571306-71571306
AGintronicDe novo--Satterstrom2020 E
Trost2022 G
CALN1     SP0007514chr7:
71743811-71743811
CTintronicDe novo--Fu2022 E
Trost2022 G
CALN1     AU3399302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CALN1     AU3190305chr7:
71737747-71737747
TCintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0632-003chr7:
71616567-71616568
CTCintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     AU1448301chr7:
71842908-71842908
CGintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     1-0025-004chr7:
71673946-71673946
CAintronicDe novo, Paternal--Trost2022 G
Yuen2017 G
CALN1     1-0126-004chr7:
71688066-71688066
CGintronicDe novo--Trost2022 G
Yuen2017 G
CALN1     2-1305-003chr7:
71940668-71940668
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
CALN1     iHART2999chr7:
71868249-71868249
CCGGexonicMaternalframeshift insertionNM_031468c.105_106insCCp.D36fs--Ruzzo2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More