
Results for "GCOM1"

Variant Events: 19

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
GCOM1     1-0373-003chr15:
AGintergenicDe novo--Yuen2017 G
GCOM1     AU08903chr15:
CTexonicDe novononsynonymous SNVNM_001018090
21.2-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
GCOM1     1-0777-003chr15:
TCintergenicDe novo--Yuen2017 G
GCOM1     AU4219302chr15:
GTintronicDe novo--Yuen2017 G
GCOM1     08C76793chr15:
CAexonicDe novononsynonymous SNVNM_001018102
14.74-Satterstrom2020 E
GCOM1     2-1278-003chr15:
GTintergenicDe novo--Yuen2017 G
GCOM1     2-1741-003chr15:
AGintergenicDe novo--Yuen2017 G
GCOM1     AU1795301chr15:
GCintergenicDe novo--Yuen2017 G
GCOM1     2-1480-003chr15:
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
GCOM1     AU076704chr15:
GAintronicDe novo--Yuen2017 G
GCOM1     1-0551-004chr15:
GAintergenicDe novo--Yuen2017 G
GCOM1     AU056803chr15:
ACintergenicDe novo--Yuen2017 G
GCOM1     13757.p1 Complex Event; expand row to view variants  De novononframeshift deletionNM_015532
--Iossifov2014 E
Kosmicki2017 E
O’Roak2012b E
O’Roak2014 T
Satterstrom2020 E
Wilfert2021 G
GCOM1     2-0129-004chr15:
TCintergenicDe novo--Yuen2017 G
GCOM1     AU000704chr15:
ACCACintergenicDe novo--Yuen2017 G
GCOM1     2-1605-003chr15:
TCintergenicDe novo--Yuen2017 G
GCOM1     AU4336301chr15:
CTCTGTCTGTCTCTCTGTCTintergenicDe novo--Yuen2017 G
GCOM1     5-0040-003chr15:
CTintergenicDe novo--Yuen2017 G
GCOM1     AU060403chr15:
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView