or
or
Exact

Results for "ATG4C"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ATG4C     13043.p1chr1:
63370518-63370519
CTCintergenicDe novo--Wilfert2021 G
ATG4C     2-0149-003chr1:
63487207-63487207
CTintergenicDe novo--Yuen2017 G
ATG4C     iHART1510chr1:
63284779-63284780
AGAexonicPaternalframeshift deletionNM_032852
NM_178221
c.499delG
c.499delG
p.G167fs
p.G167fs
--Ruzzo2019 G
ATG4C     12493.p1chr1:
63511978-63511978
AGintergenicDe novo--Turner2016 G
ATG4C     AU028305chr1:
63545517-63545517
AGintergenicDe novo--Yuen2017 G
ATG4C     11835.p1chr1:
63408953-63408953
TCintergenicDe novo--Wilfert2021 G
ATG4C     5-0117-003chr1:
63524666-63524666
TGintergenicDe novo--Yuen2017 G
ATG4C     2-1645-003chr1:
63480578-63480581
AGGGAGintergenicDe novo--Yuen2017 G
ATG4C     1-0609-003chr1:
63566703-63566703
ACintergenicDe novo--Yuen2017 G
ATG4C     1-0556-003chr1:
63610101-63610101
TCintergenicDe novo--Yuen2017 G
ATG4C     2-1359-003chr1:
63269814-63269814
GAintronicDe novo--Yuen2017 G
ATG4C     2-1690-003chr1:
63356539-63356554
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
ATG4C     A19chr1:
63484755-63484755
CAintergenicDe novo--Wu2018 G
ATG4C     3-0448-000chr1:
63436898-63436898
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
ATG4C     AU024607chr1:
63391676-63391676
TCintergenicDe novo--Yuen2017 G
ATG4C     2-1438-003chr1:
63363818-63363818
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
ATG4C     2-1317-003chr1:
63448698-63448698
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More