or
or
Exact

Results for "PFKFB3"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PFKFB3     AU3729301chr10:
6268776-6268776
CTintronicDe novo--Yuen2017 G
PFKFB3     13437.p1chr10:
6229912-6229912
TTTCTATCTATCTATCTAintronicDe novo--Wilfert2021 G
PFKFB3     2-1177-003chr10:
6263395-6263395
CTexonicDe novononsynonymous SNVNM_001145443
NM_001282630
NM_001314063
NM_004566
c.C823T
c.C925T
c.C883T
c.C883T
p.R275C
p.R309C
p.R295C
p.R295C
21.16.667E-5Yuen2016 G
Yuen2017 G
PFKFB3     AU4212303chr10:
6200031-6200031
GAintronicDe novo--Yuen2017 G
PFKFB3     AU0638302chr10:
6352576-6352588
GACTCTACTCTACGACTCTACintergenicDe novo--Yuen2017 G
PFKFB3     5-0111-003chr10:
6274701-6274701
GAintronicDe novo--Yuen2017 G
PFKFB3     2-1277-004chr10:
6335745-6335745
TTAGintergenicDe novo--Yuen2017 G
PFKFB3     AU3801301chr10:
6284740-6284740
AGintergenicDe novo--Yuen2017 G
PFKFB3     1635002chr10:
6265956-6265956
GAexonicDe novononsynonymous SNVNM_001145443
NM_001282630
NM_001314063
NM_004566
c.G1189A
c.G1291A
c.G1249A
c.G1249A
p.V397I
p.V431I
p.V417I
p.V417I
14.985.0E-4Satterstrom2020 E
PFKFB3     2-1277-003chr10:
6335745-6335745
TTAGintergenicDe novo--Yuen2017 G
PFKFB3     AU4234303chr10:
6203576-6203576
TCintronicDe novo--Yuen2017 G
PFKFB3     AU4234303chr10:
6253778-6253778
CGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More