or
or
Exact

Results for "GRIK4"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GRIK4     09C82563chr11:
120690516-120690516
GTexonicDe novononsynonymous SNVNM_001282470
NM_001282473
NM_014619
c.G398T
c.G398T
c.G398T
p.R133I
p.R133I
p.R133I
28.0-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
GRIK4     AU3918302chr11:
120772419-120772419
GAintronicDe novo--Yuen2017 G
GRIK4     AU060004chr11:
120420210-120420210
CTintronicDe novo--Yuen2017 G
GRIK4     1-0261-004chr11:
120478010-120478010
CTintronicDe novo--Yuen2017 G
GRIK4     AU3721302chr11:
120734048-120734048
GAintronicDe novo--Yuen2017 G
GRIK4     A25chr11:
120390893-120390893
CTintronicDe novo--Wu2018 G
GRIK4     1-0531-003chr11:
120622748-120622748
CGintronicDe novo--Yuen2016 G
Yuen2017 G
GRIK4     AU2951302chr11:
120449621-120449621
CTintronicDe novo--Yuen2017 G
GRIK4     13649.p1chr11:
120658896-120658896
AGintronicDe novo--Turner2016 G
GRIK4     1-0051-004chr11:
120872269-120872269
TTCAAintergenicDe novo--Yuen2017 G
GRIK4     14637.p1chr11:
120699626-120699626
GAintronicDe novo--Turner2016 G
GRIK4     2-1430-003chr11:
120562853-120562853
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GRIK4     2-1402-003chr11:
120495291-120495291
CTintronicDe novo--Yuen2017 G
GRIK4     5-0131-003chr11:
120715924-120715924
GCintronicDe novo--Yuen2017 G
GRIK4     AU2777302chr11:
120738545-120738545
CTintronicDe novo--Yuen2017 G
GRIK4     AU075703chr11:
120579120-120579120
CTintronicDe novo--Yuen2017 G
GRIK4     AU046707chr11:
120680172-120680172
CTintronicDe novo--Yuen2017 G
GRIK4     iHART3297chr11:
120702650-120702651
ACAexonicPaternalframeshift deletionNM_001282470
NM_001282473
NM_014619
c.602delC
c.602delC
c.602delC
p.T201fs
p.T201fs
p.T201fs
--Ruzzo2019 G
GRIK4     2-0319-004chr11:
120433928-120433928
GTintronicDe novo--Yuen2017 G
GRIK4     7-0219-003chr11:
120435614-120435614
GAintronicDe novo--Yuen2017 G
GRIK4     13825.p1chr11:
120674783-120674783
TCintronicDe novo--Wilfert2021 G
GRIK4     7-0032-003chr11:
120788498-120788498
TCintronicDe novo--Yuen2017 G
GRIK4     1-0466-003chr11:
120717962-120717962
AGintronicDe novo--Yuen2017 G
GRIK4     AU3728301chr11:
120491942-120491942
TGintronicDe novo--Yuen2017 G
GRIK4     5-0103-003chr11:
120414524-120414524
AGintronicDe novo--Yuen2017 G
GRIK4     AU2951303chr11:
120449621-120449621
CTintronicDe novo--Yuen2017 G
GRIK4     2-1477-003chr11:
120662944-120662976
CGTGTGTGTGTGTGTGTGCGTGTGTGTGTGTGTCGTGTGTGTGTGTGTGCGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
GRIK4     1-0590-003chr11:
120508586-120508606
TTTATTATTATTATTATTATTTTTATTATTATTATTATTintronicDe novo--Yuen2017 G
GRIK4     2-1252-003chr11:
120444344-120444344
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More