or
or
Exact

Results for "C10orf90"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
C10orf90     2-1250-003chr10:
128590711-128590711
TTTAAAintergenicDe novo--Yuen2017 G
C10orf90     AU026604chr10:
128255120-128255120
CTintergenicDe novo--Yuen2017 G
C10orf90     AU028305chr10:
128496680-128496680
GTintergenicDe novo--Yuen2017 G
C10orf90     200675704@1082034185chr10:
128158606-128158722
ATGCATGCTGCAGAGAAGGAGGGAAGGTGTTCTTCTGCATGTTGCATACTGCAGGGGGGAAGGCACTCTTCTGCATGTTGTGTCCTGCAGTGGAGGAAAAGGCATTCTTCTGTAGGTAintronicDe novo--Satterstrom2020 E
C10orf90     2-1734-003chr10:
128282271-128282271
AGintergenicDe novo--Yuen2017 G
C10orf90     2-1430-003chr10:
128362598-128362598
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
C10orf90     2-1314-003chr10:
128420938-128420938
ACintergenicDe novo--Yuen2016 G
C10orf90     AU4284301chr10:
128587095-128587099
AACACAACintergenicDe novo--Yuen2017 G
C10orf90     13515.p1chr10:
128333497-128333497
ATintergenicDe novo--Turner2016 G
C10orf90     A28chr10:
128168115-128168115
GAintronicDe novo--Wu2018 G
C10orf90     2-1715-004chr10:
128234116-128234116
AGintergenicDe novo--Yuen2017 G
C10orf90     2-0244-003chr10:
128576629-128576629
TAintergenicDe novo--Yuen2017 G
C10orf90     10C107588chr10:
128118361-128118361
AGexonicDe novosynonymous SNVNM_001004298c.T1956Cp.S652S9.428-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
C10orf90     2-0244-003chr10:
128486444-128486454
CCACTGGGCTTCintergenicDe novo--Yuen2017 G
C10orf90     1-0191-004chr10:
128471095-128471095
ACintergenicDe novo--Yuen2017 G
C10orf90     1-0197-004chr10:
128396447-128396447
GAintergenicDe novo--Yuen2017 G
C10orf90     5-0131-003chr10:
128296185-128296185
GAintergenicDe novo--Yuen2017 G
C10orf90     14093.p1chr10:
128446837-128446837
CCTintergenicDe novo--Wilfert2021 G
C10orf90     5090_childchr10:
128118361-128118361
AGexonicDe novosynonymous SNVNM_001004298c.T1956Cp.S652S9.428-Neale2012 E
C10orf90     AU3768302chr10:
128551219-128551219
GCintergenicDe novo--Yuen2017 G
C10orf90     14563.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_001004298
NM_001004298
c.207dupC
c.206dupC
p.L70fs
p.S69fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
C10orf90     2-1127-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More