or
or
Exact

Results for "PDE4B"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PDE4B     AU3779302chr1:
66683376-66683376
TGintronicDe novo--Yuen2017 G
PDE4B     SSC05963chr1:
66833455-66833455
GAexonicDe novosynonymous SNVNM_001037339
NM_001297442
NM_001037340
NM_001297440
NM_001297441
NM_001037341
NM_002600
c.G945A
c.G762A
c.G1416A
c.G1185A
c.G1236A
c.G1461A
c.G1461A
p.L315L
p.L254L
p.L472L
p.L395L
p.L412L
p.L487L
p.L487L
-8.248E-6Lim2017 E
PDE4B     AU1952305chr1:
66838314-66838314
AGexonicDe novononsynonymous SNVNM_001037339
NM_001297442
NM_001037340
NM_001297440
NM_001297441
NM_001037341
NM_002600
c.A1648G
c.A1465G
c.A2119G
c.A1888G
c.A1939G
c.A2164G
c.A2164G
p.T550A
p.T489A
p.T707A
p.T630A
p.T647A
p.T722A
p.T722A
8.2652.0E-4Yuen2017 G
PDE4B     5-0014-003chr1:
66939746-66939746
TGintergenicDe novo--Yuen2017 G
PDE4B     12691.p1chr1:
66833455-66833455
GAexonicDe novosynonymous SNVNM_001037339
NM_001297442
NM_001037340
NM_001297440
NM_001297441
NM_001037341
NM_002600
c.G945A
c.G762A
c.G1416A
c.G1185A
c.G1236A
c.G1461A
c.G1461A
p.L315L
p.L254L
p.L472L
p.L395L
p.L412L
p.L487L
p.L487L
-8.248E-6Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
PDE4B     2-1288-003chr1:
66437734-66437734
GTintronicDe novo--Yuen2017 G
PDE4B     5-0111-003chr1:
66965729-66965729
GAintergenicDe novo--Yuen2017 G
PDE4B     AU2109301chr1:
66677316-66677316
GAintronicDe novo--Yuen2017 G
PDE4B     1-0215-006chr1:
66624803-66624803
TCintronicDe novo--Yuen2017 G
PDE4B     2-1205-003chr1:
66841754-66841754
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
PDE4B     2-0210-004chr1:
66934984-66934984
CGintergenicDe novo--Yuen2017 G
PDE4B     AU3913302chr1:
66402041-66402041
CAintronicDe novo--Yuen2017 G
PDE4B     AU4286302chr1:
66812442-66812442
AGintronicDe novo--Yuen2017 G
PDE4B     iHART3217chr1:
66838335-66838335
GTexonicPaternalstopgainNM_001037339
NM_001297442
NM_001037340
NM_001297440
NM_001297441
NM_001037341
NM_002600
c.G1669T
c.G1486T
c.G2140T
c.G1909T
c.G1960T
c.G2185T
c.G2185T
p.E557X
p.E496X
p.E714X
p.E637X
p.E654X
p.E729X
p.E729X
24.28.369E-6Ruzzo2019 G
PDE4B     2-1177-003chr1:
66457590-66457590
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4B     5-0087-003chr1:
66718352-66718352
GAintronicDe novo--Yuen2017 G
PDE4B     2-1222-003chr1:
66624337-66624337
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PDE4B     AU047703chr1:
66766674-66766674
TAintronicDe novo--Yuen2017 G
PDE4B     2-1371-003chr1:
66984753-66984768
GCACACACACACACACGCACACACACACACintergenicDe novo--Yuen2017 G
PDE4B     AU2950302chr1:
66577438-66577438
AGintronicDe novo--Yuen2017 G
PDE4B     AU2756306chr1:
66424431-66424448
ACGCGCGCGCGCGCGCGCACGCGCGCGCGCGCGCintronicDe novo--Yuen2017 G
PDE4B     2-0309-005chr1:
66554382-66554382
GAintronicDe novo--Yuen2017 G
PDE4B     1-0203-004chr1:
66608354-66608354
GAintronicDe novo--Yuen2017 G
PDE4B     1-0269-003chr1:
66627677-66627677
ATintronicDe novo--Yuen2017 G
PDE4B     AU066206chr1:
66407268-66407273
CAGTGACAGTGAGTGAintronicDe novo--Yuen2017 G
PDE4B     AU3801301chr1:
66525799-66525799
AGintronicDe novo--Yuen2017 G
PDE4B     1-0627-006chr1:
66599104-66599104
CAintronicDe novo--Yuen2017 G
PDE4B     1-0564-003chr1:
66470520-66470539
GTTTATTTATTTATTTATTTGTTTATTTATTTATTTintronicDe novo--Yuen2017 G
PDE4B     1-0534-004chr1:
66799239-66799239
CTintronicDe novo--Yuen2017 G
PDE4B     1-0112-003chr1:
66330500-66330500
CTintronicDe novo--Yuen2017 G
PDE4B     1-0661-003chr1:
66833666-66833666
CAexonicDe novononsynonymous SNVNM_001037339
NM_001297442
NM_001037340
NM_001297440
NM_001297441
NM_001037341
NM_002600
c.C1064A
c.C881A
c.C1535A
c.C1304A
c.C1355A
c.C1580A
c.C1580A
p.A355E
p.A294E
p.A512E
p.A435E
p.A452E
p.A527E
p.A527E
27.3-Yuen2017 G
PDE4B     AU2988302chr1:
66472433-66472433
CGintronicDe novo--Yuen2017 G
PDE4B     3-0307-000chr1:
66865878-66865878
CTintergenicDe novo--Yuen2017 G
PDE4B     AU3900302chr1:
66572458-66572458
GAintronicDe novo--Yuen2017 G
PDE4B     1-0158-012chr1:
66711645-66711645
ACintronicDe novo--Yuen2017 G
PDE4B     2-1093-003chr1:
66421680-66421680
CGintronicDe novo--Yuen2017 G
PDE4B     AU3125301chr1:
66275142-66275142
TGintronicDe novo--Yuen2017 G
PDE4B     AU2988303chr1:
66472433-66472433
CGintronicDe novo--Yuen2017 G
PDE4B     AU4237304chr1:
66964296-66964296
GTintergenicDe novo--Yuen2017 G
PDE4B     AU4145303chr1:
66468951-66468951
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More