or
or
Exact

Results for "GALNT9"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GALNT9     1-0541-004chr12:
132896926-132896926
GAintronicDe novo--Yuen2017 G
GALNT9     1-0482-003chr12:
132848442-132848442
GCintronicDe novo--Yuen2016 G
GALNT9     A2chr12:
132689038-132689038
GAintronicDe novo--Wu2018 G
GALNT9     2-1441-003chr12:
132860898-132860913
GCACACACACACACACGCACACACACACACintronicDe novo--Yuen2017 G
GALNT9     AU2075301chr12:
132858989-132858989
GAintronicDe novo--Yuen2017 G
GALNT9     AU3888302chr12:
132839246-132839246
GAintronicDe novo-0.02Yuen2017 G
GALNT9     1-0556-003chr12:
132874582-132874582
CAintronicDe novo--Yuen2017 G
GALNT9     AU4239301chr12:
132898861-132898861
CTintronicDe novo--Yuen2017 G
GALNT9     EGAN00001101176chr12:
132862964-132862964
ACexonicDe novosynonymous SNVNM_001122636c.T291Gp.G97G-5.0E-4Satterstrom2020 E
GALNT9     12626.p1chr12:
132688118-132688118
GAexonicDe novononsynonymous SNVNM_021808
NM_001122636
c.C97T
c.C1195T
p.R33C
p.R399C
17.941.664E-5Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
GALNT9     2-1696-003chr12:
132705492-132705492
CTintronicDe novo--Yuen2017 G
GALNT9     AU076509chr12:
132689724-132689724
GCintronicDe novo--Yuen2017 G
GALNT9     NDAR_INVWL738LDP_wes1chr12:
132681729-132681729
CAexonicDe novononsynonymous SNVNM_021808
NM_001122636
c.G637T
c.G1735T
p.G213W
p.G579W
23.7-Lim2017 E
GALNT9     1-0231-004chr12:
132702040-132702040
CCATintronicDe novo--Yuen2017 G
GALNT9     AU2950301chr12:
132810452-132810462
GACACACACACGACACACACintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More