or
or
Exact

Results for "ARHGEF10"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARHGEF10     2-1425-003chr8:
1836658-1836658
AGintronicDe novo--Yuen2017 G
ARHGEF10     1-0296-004chr8:
1806385-1806385
CAintronicDe novo--Yuen2017 G
ARHGEF10     DEASD_0264_001chr8:
1876856-1876856
CTintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
ARHGEF10     A15chr8:
1893674-1893674
GTexonicDe novononsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.G3136T
c.G3250T
c.G3322T
p.G1046C
p.G1084C
p.G1108C
20.58.288E-5Wu2018 G
ARHGEF10     A26chr8:
1824869-1824869
GCexonicDe novononsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.G815C
c.G812C
c.G887C
p.R272T
p.R271T
p.R296T
13.78-Wu2018 G
ARHGEF10     2-1422-003chr8:
1843742-1843742
GAintronicDe novo--Yuen2017 G
ARHGEF10     A22chr8:
1876605-1876605
AGexonicDe novononsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.A2596G
c.A2710G
c.A2782G
p.T866A
p.T904A
p.T928A
7.7161.647E-5Wu2018 G
ARHGEF10     2-0244-003chr8:
1873953-1873953
TGintronicDe novo--Yuen2017 G
ARHGEF10     2-1338-003chr8:
1885662-1885662
CTintronicDe novo--Yuen2017 G
ARHGEF10     A12chr8:
1808233-1808233
CTexonicDe novononsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.C364T
c.C364T
c.C436T
p.P122S
p.P122S
p.P146S
5.68-Wu2018 G
ARHGEF10     2-1089-004chr8:
1849143-1849143
GAintronicDe novo--Yuen2017 G
ARHGEF10     A31chr8:
1806182-1806182
GAexonicDe novononsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.G94A
c.G94A
c.G166A
p.D32N
p.D32N
p.D56N
15.258.241E-6Wu2018 G
ARHGEF10     Li2017:16251chr8:
1877564-1877564
GAexonicDe novononsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.G2920A
c.G3034A
c.G3106A
p.A974T
p.A1012T
p.A1036T
19.983.304E-5Li2017 T
ARHGEF10     A20chr8:
1911297-1911297
CTintergenicDe novo--Wu2018 G
ARHGEF10     2-1251-003chr8:
1808407-1808407
CTintronicDe novo--Yuen2017 G
ARHGEF10     AU053503chr8:
1796168-1796168
GTintronicDe novo--Yuen2017 G
ARHGEF10     2-0149-004chr8:
1806389-1806389
GTintronicDe novo--Yuen2017 G
ARHGEF10     1-0863-003chr8:
1893988-1893988
GAintronicDe novo--Yuen2017 G
ARHGEF10     13946.p1chr8:
1846865-1846865
ATintronicDe novo--Turner2016 G
ARHGEF10     Li2017:19625chr8:
1893759-1893759
CTexonicUnknownnonsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.C3221T
c.C3335T
c.C3407T
p.T1074M
p.T1112M
p.T1136M
16.266.596E-5Li2017 T
ARHGEF10     3-0428-000chr8:
1841972-1841972
ACintronicDe novo--Yuen2016 G
Yuen2017 G
ARHGEF10     Li2017:16283chr8:
1817380-1817380
GCexonicUnknownnonsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.G646C
c.G643C
c.G718C
p.D216H
p.D215H
p.D240H
25.5-Li2017 T
ARHGEF10     AU3885304chr8:
1916248-1916248
CAintergenicDe novo--Yuen2017 G
ARHGEF10     AU3918301chr8:
1784788-1784788
GTintronicDe novo--Yuen2017 G
ARHGEF10     2-1094-004chr8:
1873958-1873958
GAintronicDe novo--Yuen2017 G
ARHGEF10     14207.p1chr8:
1830777-1830777
CTintronicDe novo--Satterstrom2020 E
ARHGEF10     2-1327-004chr8:
1806381-1806382
AGAintronicDe novo--Yuen2017 G
ARHGEF10     7-0194-003chr8:
1876443-1876449
ATTGTTTATTintronicDe novo--Yuen2017 G
ARHGEF10     NDAR_INVVN663TWC_wes1chr8:
1806141-1806141
AGexonicDe novononsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.A53G
c.A53G
c.A125G
p.Y18C
p.Y18C
p.Y42C
0.4511.655E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
ARHGEF10     2-0215-003chr8:
1893345-1893345
CAintronicDe novo--Yuen2017 G
ARHGEF10     1-0518-003chr8:
1808482-1808482
GAintronicDe novo--Yuen2017 G
ARHGEF10     2-0215-003chr8:
1883392-1883392
CGintronicDe novo--Yuen2017 G
ARHGEF10     2-0215-003chr8:
1882332-1882332
CAintronicDe novo--Yuen2017 G
ARHGEF10     1-0022-003chr8:
1915036-1915036
TCintergenicDe novo--Yuen2016 G
ARHGEF10     1-0022-004chr8:
1915036-1915036
TCintergenicDe novo--Yuen2017 G
ARHGEF10     iHART3267chr8:
1806283-1806283
TCsplicingMaternalsplicing11.218.675E-6Ruzzo2019 G
ARHGEF10     07C66440chr8:
1851409-1851409
CTintronicDe novo--Satterstrom2020 E
ARHGEF10     Li2017:23266chr8:
1814753-1814753
AGexonicUnknownnonsynonymous SNVNM_001308152
NM_014629
NM_001308153
c.A610G
c.A607G
c.A682G
p.T204A
p.T203A
p.T228A
25.68.258E-6Li2017 T
ARHGEF10     2-1127-003chr8:
1840805-1840817
ATGTGTGTGTGTGATGTGTGTGTGintronicDe novo--Yuen2017 G
ARHGEF10     iHART3265chr8:
1806283-1806283
TCsplicingMaternalsplicing11.218.675E-6Ruzzo2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More