or
or
Exact

Results for "ARHGAP21"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARHGAP21     A31chr10:
24883925-24883925
AACAAAAexonicDe novoframeshift insertionNM_020824c.3829_3830insTTTTGp.L1277fs--Wu2018 G
ARHGAP21     AU4028302chr10:
24931755-24931755
CTintronicDe novo--Yuen2017 G
ARHGAP21     A31chr10:
24883878-24883888
CCTTATTTTTTCexonicDe novoframeshift deletionNM_020824c.3867_3876delp.E1289fs--Wu2018 G
ARHGAP21     1-0488-003chr10:
24885247-24885247
CTintronicDe novo--Yuen2017 G
ARHGAP21     AU3610302chr10:
25128054-25128054
AGintergenicDe novo--Yuen2017 G
ARHGAP21     7-0100-003chr10:
24876395-24876395
AACTATCAAAGintronicDe novo--Yuen2017 G
ARHGAP21     AU027506chr10:
25076959-25076959
AGintergenicDe novo--Yuen2017 G
ARHGAP21     AU2293302chr10:
25065113-25065113
GTintergenicDe novo--Yuen2017 G
ARHGAP21     5-0095-003chr10:
24967845-24967845
CTintronicDe novo--Yuen2017 G
ARHGAP21     Li2017:20559chr10:
24908449-24908449
GAexonicUnknownnonsynonymous SNVNM_020824c.C2375Tp.S792L23.19.068E-5Li2017 T
ARHGAP21     AU018010chr10:
25009076-25009076
CGintronicDe novo--Yuen2017 G
ARHGAP21     SP0049129chr10:
24923997-24923997
TCexonicDe novononsynonymous SNVNM_020824c.A304Gp.I102V23.8-Feliciano2019 E
ARHGAP21     1-0484-003chr10:
25059424-25059444
GAGAGCGTAAAGGAAAGGAAAGintergenicDe novo--Yuen2017 G
ARHGAP21     2-1355-004chr10:
24891928-24891931
AATCAintronicDe novo--Yuen2017 G
ARHGAP21     AU3782302chr10:
24994514-24994514
GAintronicDe novo--Yuen2017 G
ARHGAP21     12645.p1chr10:
24896811-24896811
AGexonicDe novononsynonymous SNVNM_020824c.T2444Cp.I815T13.0-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
ARHGAP21     1-0121-003chr10:
24916513-24916516
CTTTCTintronicDe novo--Yuen2017 G
ARHGAP21     Li2017:23258chr10:
24885704-24885704
GAexonicUnknownstopgainNM_020824c.C3442Tp.R1148X40.0-Li2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More