or
or
Exact

Results for "RPS6KA6"

Variant Events: 9

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RPS6KA6     7-0133-003chrX:
83325395-83325395
CGintronicDe novo--Yuen2017 G
RPS6KA6     iHART2164chrX:
83360794-83360794
CAsplicingUnknownsplicing18.16-Ruzzo2019 G
RPS6KA6     iHART2163chrX:
83360794-83360794
CAsplicingMaternalsplicing18.16-Ruzzo2019 G
RPS6KA6     AU3729303chrX:
83372651-83372651
CAintronicDe novo--Yuen2017 G
RPS6KA6     AU1988301chrX:
83527681-83527690
GAAAAAAAAAGAAAAAAAAAAintergenicDe novo--Yuen2017 G
RPS6KA6     1-0651-003chrX:
83396486-83396494
CAAAAAAAACAAAAAAAAAintronicDe novo--Yuen2017 G
RPS6KA6     AU061104chrX:
83405910-83405917
GATATATAGATATATATATAintronicDe novo--Yuen2017 G
RPS6KA6     AU4197301chrX:
83517035-83517035
TGintergenicDe novo--Yuen2017 G
RPS6KA6     Al-Mubarak2017:ASD-64chrX:
83359586-83359586
TCexonicUnknownnonsynonymous SNVNM_014496c.A1535Gp.Q512R15.58-Al-Mubarak2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More