
Results for "GSN"

Variant Events: 14

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
GSN     SP0109153chr9:
TCintronicDe novo--Fu2022 E
GSN     SP0008182chr9:
CTexonicDe novononsynonymous SNVNM_000177
21.34.124E-5Fu2022 E
GSN     12906.p1chr9:
TCintronicDe novo--Satterstrom2020 E
GSN     AU054303chr9:
CGintronicDe novo--Yuen2017 G
GSN     PN400281chr9:
CTexonicUnknownnonsynonymous SNVNM_000177
24.1-Leblond2019 E
GSN     Codina-Sola2015:ASD_27chr9:
AGexonicPaternalnonsynonymous SNVNM_000177
14.04-Codina-Sola2015 E
GSN     PN400267chr9:
GAexonicUnknownnonsynonymous SNVNM_000177
33.00.005Leblond2019 E
GSN     PN400491chr9:
GAexonicUnknownnonsynonymous SNVNM_000177
33.00.005Leblond2019 E
GSN     PN400232chr9:
GAexonicUnknownnonsynonymous SNVNM_000177
33.00.005Leblond2019 E
GSN     1-0201-005chr9:
TAintronicDe novo--Yuen2017 G
GSN     PN400231chr9:
GAexonicUnknownnonsynonymous SNVNM_000177
33.00.005Leblond2019 E
GSN     iHART1768chr9:
GAsplicingPaternalsplicing21.06.679E-5Ruzzo2019 G
GSN     iHART2239chr9:
CCGCACCGCCCCGCGCCCGCGCTGCTTTGCexonicMaternalframeshift deletionNM_000177c.8_35delp.P3fs--Ruzzo2019 G
GSN     PN400363chr9:
GAexonicUnknownnonsynonymous SNVNM_000177
33.00.005Leblond2019 E
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView