
Results for "NIN"

Variant Events: 20

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
NIN     1-0112-004chr14:
GAintronicDe novo-2.503E-5Yuen2017 G
NIN     F9958-1chr14:
CGexonicDe novononsynonymous SNVNM_016350
15.96-Fu2022 E
Satterstrom2020 E
NIN     SP0046604chr14:
ATintronicDe novo--Fu2022 E
NIN     1-0978-003chr14:
GAintronicDe novo--Yuen2017 G
NIN     SP0080277chr14:
TCintronicDe novo--Fu2022 E
NIN     Li2017:19563chr14:
TCexonicUnknownnonsynonymous SNVNM_016350
25.8-Li2017 T
NIN     1-0539-003chr14:
TCintergenicDe novo--Yuen2017 G
NIN     2-1391-003chr14:
GGAintergenicDe novo--Yuen2017 G
NIN     1-0559-003chr14:
GAintronicDe novo--Yuen2017 G
NIN     AU4306302chr14:
CTintergenicDe novo--Yuen2017 G
NIN     2-1154-003chr14:
GTintronicDe novo--Yuen2016 G
Yuen2017 G
NIN     2-1358-003chr14:
GAintergenicDe novo--Yuen2017 G
NIN     iHART2474chr14:
38.0-Ruzzo2019 G
NIN     09C96267chr14:
GGTAAGTACAAAGGGGTATTTCTGAintronicDe novo--Satterstrom2020 E
NIN     Li2017:20609chr14:
TTGexonicUnknownframeshift insertionNM_016350
--Li2017 T
NIN     iHART2473chr14:
38.0-Ruzzo2019 G
NIN     14391_p1chr14:
TCintronicDe novo--Fu2022 E
NIN     SP0035185chr14:
GAUTR3De novo--Fu2022 E
NIN     13183.p1chr14:
AATAexonicDe novoframeshift deletionNM_020921
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
NIN     14391.p1chr14:
TCintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView