Variant Results

or

or

Results for "ZNF208"

Variant Events: 10

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
ZNF208	08C74853	chr19: 22155291-22155291	T	A	exonic		De novo	nonsynonymous SNV	NM_007153	c.A2545T	p.T849S	5.913	8.496E-6	Satterstrom2020 E Trost2022 G Zhou2022 GE
ZNF208	09C98400	chr19: 22154342-22154426	ACAGTATGAATTTTCTTATGATAACTAAGGGTTGAGGACCACTTATAGGCTTTGCCACATTCTTCACATTTGTAGGGTTTCTCTC	A	exonic		De novo	nonframeshift deletion	NM_007153	c.3410_3493del	p.1137_1165del	-	-	Satterstrom2020 E Trost2022 G Zhou2022 GE
ZNF208	1-1004-003	chr19: 22164236-22164236	C	T	intronic		De novo					-	-	Trost2022 G Yuen2017 G
ZNF208	SP0237182	chr19: 22157439-22157439	G	C	exonic		De novo	nonsynonymous SNV	NM_007153	c.C397G	p.L133V	0.418	-	Trost2022 G
ZNF208	SP0041707	chr19: 22154752-22154752	G	A	exonic		De novo	synonymous SNV	NM_007153	c.C3084T	p.P1028P	-	-	Fu2022 E Trost2022 G Zhou2022 GE
ZNF208	SP0091950	chr19: 22155978-22155979	TA	T	exonic		De novo	frameshift deletion	NM_007153	c.1857delT	p.S619fs	-	2.491E-5	Fu2022 E
ZNF208	Cukier2014:17351	chr19: 22154331-22154331	A	G	exonic		Unknown	nonsynonymous SNV	NM_007153	c.T3505C	p.Y1169H	14.22	7.0E-4	Cukier2014 E
ZNF208	SP0049528	chr19: 22155978-22155979	TA	T	exonic		De novo	frameshift deletion	NM_007153	c.1857delT	p.S619fs	-	2.491E-5	Fu2022 E
ZNF208	Cukier2014:17351	chr19: 22155362-22155362	G	C	exonic		Unknown	nonsynonymous SNV	NM_007153	c.C2474G	p.A825G	7.475	7.0E-4	Cukier2014 E
ZNF208	1-0279-004	chr19: 22154951-22154951	T	C	exonic		De novo	nonsynonymous SNV	NM_007153	c.A2885G	p.Y962C	5.33	8.466E-6	Yuen2015 G Yuen2017 G Zhou2022 GE

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More