or
or
Exact

Results for "NDST4"

Variant Events: 85

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NDST4     AU028305chr4:
116392604-116392604
AGintergenicDe novo--Yuen2017 G
NDST4     2-1264-003chr4:
115872947-115872947
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NDST4     2-0135-003chr4:
116384932-116384932
AGintergenicDe novo--Yuen2017 G
NDST4     2-0242-005chr4:
116217224-116217224
TCintergenicDe novo--Yuen2017 G
NDST4     2-1359-003chr4:
117088132-117088132
CTintergenicDe novo--Yuen2017 G
NDST4     AU1860301chr4:
116307303-116307303
AGintergenicDe novo--Yuen2017 G
NDST4     2-0135-003chr4:
116374161-116374161
TGintergenicDe novo--Yuen2017 G
NDST4     7-0044-003chr4:
116984383-116984383
GAintergenicDe novo--Yuen2017 G
NDST4     1-0092-003chr4:
116653470-116653470
TTAAGCAAintergenicDe novo--Yuen2017 G
NDST4     1-0898-003chr4:
116699196-116699196
AGintergenicDe novo--Yuen2017 G
NDST4     AU4392302chr4:
116078911-116078911
TAintergenicDe novo--Yuen2017 G
NDST4     AU079204chr4:
116500023-116500023
ATintergenicDe novo--Yuen2017 G
NDST4     7-0023-003chr4:
116013948-116013948
ATintronicDe novo--Yuen2017 G
NDST4     2-1429-004chr4:
116217224-116217224
TCintergenicDe novo--Yuen2017 G
NDST4     2-0208-004chr4:
117053400-117053405
AAGTCTAintergenicDe novo--Yuen2017 G
NDST4     1-0454-003chr4:
116913099-116913102
CTATCTintergenicDe novo--Yuen2017 G
NDST4     1-0563-004chr4:
116217224-116217224
TCintergenicDe novo--Yuen2017 G
NDST4     2-1509-003chr4:
116911069-116911083
TACACACACACACACTACACACACACACintergenicDe novo--Yuen2017 G
NDST4     3-0140-000chr4:
117055585-117055585
ACintergenicDe novo--Yuen2017 G
NDST4     AU026604chr4:
116140806-116140806
GTintergenicDe novo--Yuen2017 G
NDST4     2-0304-004chr4:
116155013-116155013
GTintergenicDe novo--Yuen2017 G
NDST4     AU031003chr4:
116692102-116692102
CAintergenicDe novo--Yuen2017 G
NDST4     AU031003chr4:
117199318-117199318
CTintergenicDe novo--Yuen2017 G
NDST4     1-0345-004chr4:
116908648-116908648
CTintergenicDe novo--Yuen2017 G
NDST4     AU024104chr4:
116167004-116167004
CAintergenicDe novo--Yuen2017 G
NDST4     2-1721-003chr4:
115991476-115991476
GAintronicDe novo--Yuen2017 G
NDST4     1-0923-003chr4:
116323858-116323858
AGintergenicDe novo--Yuen2017 G
NDST4     AU002903chr4:
115820940-115820940
TCintronicDe novo--Yuen2017 G
NDST4     11209.p1chr4:
115760701-115760701
GAexonicDe novostopgainNM_022569c.C2119Tp.Q707X46.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
NDST4     2-1315-003chr4:
115777357-115777357
TGintronicDe novo--Yuen2016 G
Yuen2017 G
NDST4     AU4410302chr4:
116657657-116657657
GAintergenicDe novo--Yuen2017 G
NDST4     11006.p1chr4:
115997959-115997959
AGexonicDe novosynonymous SNVNM_022569c.T234Cp.P78P--Iossifov2014 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
NDST4     1-0656-003chr4:
116136488-116136488
CGintergenicDe novo--Yuen2017 G
NDST4     2-0503-004chr4:
116962240-116962240
GAintergenicDe novo--Yuen2017 G
NDST4     AU3874303chr4:
116681835-116681835
ATintergenicDe novo--Yuen2017 G
NDST4     2-0208-003chr4:
117053400-117053405
AAGTCTAintergenicDe novo--Yuen2017 G
NDST4     1-0065-005chr4:
116217322-116217322
AATTTTTintergenicDe novo--Yuen2017 G
NDST4     2-1429-003chr4:
116217224-116217224
TCintergenicDe novo--Yuen2017 G
NDST4     1-0043-003chr4:
116479631-116479631
GAintergenicDe novo--Yuen2017 G
NDST4     2-0019-004chr4:
116217322-116217322
AATTTTTintergenicDe novo--Yuen2017 G
NDST4     5-0105-003chr4:
116319202-116319202
GAintergenicDe novo--Yuen2017 G
NDST4     1-0777-003chr4:
116653321-116653321
CGintergenicDe novo--Yuen2017 G
NDST4     1-0777-003chr4:
116132918-116132918
ACintergenicDe novo--Yuen2017 G
NDST4     2-0006-004chr4:
115941665-115941666
ACAintronicDe novo--Yuen2017 G
NDST4     1-0112-003chr4:
116565120-116565126
ATACTTTAintergenicDe novo--Yuen2017 G
NDST4     1-0488-003chr4:
116025863-116025863
GTintronicDe novo--Yuen2017 G
NDST4     1-0560-003chr4:
116317387-116317391
GCCCCGCCCintergenicDe novo--Yuen2017 G
NDST4     1-0279-004chr4:
117003524-117003524
CTintergenicDe novo--Yuen2017 G
NDST4     AU3779301chr4:
117112185-117112185
TCintergenicDe novo--Yuen2017 G
NDST4     1-0652-004chr4:
116217322-116217322
AATTTTTintergenicDe novo--Yuen2017 G
NDST4     2-0298-003chr4:
116334912-116334912
TCintergenicDe novo--Yuen2017 G
NDST4     2-1140-003chr4:
116096910-116096910
AGintergenicDe novo--Yuen2017 G
NDST4     AU1742302 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
NDST4     2-0198-003chr4:
116217322-116217322
AATTTTTintergenicDe novo--Yuen2017 G
NDST4     2-1269-003chr4:
115765393-115765393
TGintronicDe novo--Yuen2017 G
NDST4     AU046703chr4:
115756958-115756958
TCintronicDe novo--Yuen2017 G
NDST4     AU3858302chr4:
116252676-116252676
CGintergenicDe novo--Yuen2017 G
NDST4     AU072505chr4:
116446119-116446119
TGintergenicDe novo--Yuen2017 G
NDST4     AU3057302chr4:
117212221-117212221
AGintergenicDe novo--Yuen2017 G
NDST4     AU3761301chr4:
116463775-116463775
CAintergenicDe novo--Yuen2017 G
NDST4     2-1562-003chr4:
116142846-116142846
CTintergenicDe novo--Yuen2017 G
NDST4     1-0595-004chr4:
116388670-116388670
GTintergenicDe novo--Yuen2017 G
NDST4     SSC03263chr4:
115760701-115760701
GAexonicDe novostopgainNM_022569c.C2119Tp.Q707X46.0-Lim2017 E
NDST4     2-1252-003chr4:
116217322-116217322
AATTTTTintergenicDe novo--Yuen2017 G
NDST4     1-0209-003chr4:
116850219-116850219
CAintergenicDe novo--Yuen2017 G
NDST4     1-0901-003chr4:
116628741-116628752
AATGAGTTAAGGAintergenicDe novo--Yuen2017 G
NDST4     Lim2017:5316chr4:
115997959-115997959
AGexonicDe novosynonymous SNVNM_022569c.T234Cp.P78P--Lim2017 E
NDST4     1-1004-003chr4:
116960087-116960087
ACintergenicDe novo--Yuen2017 G
NDST4     1-0141-003chr4:
117181214-117181214
GAintergenicDe novo--Yuen2017 G
NDST4     1-0079-008chr4:
116217322-116217322
AATTTTTintergenicDe novo--Yuen2017 G
NDST4     2-0013-003chr4:
116401769-116401769
CGintergenicDe novo--Yuen2017 G
NDST4     2-1619-004chr4:
116351532-116351532
GCintergenicDe novo--Yuen2017 G
NDST4     1-0092-004chr4:
116653470-116653470
TTAAGCAAintergenicDe novo--Yuen2017 G
NDST4     AU4159301chr4:
116831576-116831576
CTintergenicDe novo--Yuen2017 G
NDST4     2-1205-003chr4:
115964042-115964042
AGintronicDe novo--Yuen2016 G
Yuen2017 G
NDST4     AU3997302chr4:
116018705-116018705
CGintronicDe novo--Yuen2017 G
NDST4     2-1255-003chr4:
116361484-116361484
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NDST4     5-0040-003chr4:
116217322-116217322
AATTTTTintergenicDe novo--Yuen2017 G
NDST4     3-0661-000chr4:
117164701-117164701
TGintergenicDe novo--Yuen2017 G
NDST4     2-1148-004chr4:
116217322-116217322
AATTTTTintergenicDe novo--Yuen2017 G
NDST4     1-0906-003chr4:
116626100-116626100
TCintergenicDe novo--Yuen2017 G
NDST4     AU3787302chr4:
116792137-116792137
GTintergenicDe novo--Yuen2017 G
NDST4     2-1398-004chr4:
116763786-116763786
GAintergenicDe novo--Yuen2017 G
NDST4     2-1148-004chr4:
116449895-116449895
GAintergenicDe novo--Yuen2017 G
NDST4     7-0183-003chr4:
116949443-116949443
GTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More