or
or
Exact

Results for "TSNARE1"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TSNARE1     1-0330-004chr8:
143353964-143353964
CCCCGCCTGTCTACACCTTCCTCTTTCCATCCACCTGTintronicDe novo--Yuen2017 G
TSNARE1     2-1408-004chr8:
143342374-143342374
AAAGAAGGGAAGintronicDe novo--Yuen2017 G
TSNARE1     2-1341-004chr8:
143432016-143432016
GAintronicDe novo--Yuen2017 G
TSNARE1     1-0158-003chr8:
143513546-143513546
CAintergenicDe novo--Yuen2017 G
TSNARE1     2-0142-003chr8:
143513595-143513595
TTCCCCCGTAACintergenicDe novo--Yuen2017 G
TSNARE1     74-0115chr8:
143516797-143516797
CTintergenicDe novo--Michaelson2012 G
TSNARE1     2-1485-003chr8:
143513617-143513617
TCintergenicDe novo--Yuen2017 G
TSNARE1     1-0394-003chr8:
143316703-143316703
GAintronicDe novo--Yuen2017 G
TSNARE1     1-0412-003chr8:
143381164-143381164
GAintronicDe novo--Yuen2017 G
TSNARE1     2-1731-003chr8:
143341025-143341025
ACintronicDe novo--Yuen2017 G
TSNARE1     AU4237302chr8:
143341841-143341841
CTintronicDe novo--Yuen2017 G
TSNARE1     A20chr8:
143412910-143412910
CTintronicDe novo--Wu2018 G
TSNARE1     AU007032chr8:
143425442-143425442
GAexonicDe novosynonymous SNVNM_145003c.C630Tp.S210S--DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TSNARE1     AU4284301chr8:
143516350-143516385
CTCGCACACACATGCACTTTCACACACACATGCACTCTCACACACACATGCACTintergenicDe novo--Yuen2017 G
TSNARE1     1-0744-003chr8:
143496539-143496539
GAintergenicDe novo--Yuen2017 G
TSNARE1     1-0756-005chr8:
143513703-143513704
TCTintergenicDe novo--Yuen2017 G
TSNARE1     iHART3237chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Ruzzo2019 G
TSNARE1     iHART3242chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Ruzzo2019 G
TSNARE1     iHART3240chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Ruzzo2019 G
TSNARE1     13557.p1chr8:
143356191-143356191
GAexonicDe novononsynonymous SNVNM_001291931
NM_145003
c.C740T
c.C1397T
p.S247L
p.S466L
9.587-Iossifov2014 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
TSNARE1     11411.p1chr8:
143425725-143425725
GCexonicDe novononsynonymous SNVNM_145003c.C347Gp.P116R8.317-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
TSNARE1     1-0606-003chr8:
143471531-143471531
GAintronicDe novo--Yuen2017 G
TSNARE1     1-0119-004chr8:
143456964-143456964
GAintronicDe novo--Yuen2017 G
TSNARE1     iHART2245chr8:
143425762-143425762
CCCCCTexonicPaternalframeshift insertionNM_145003c.309_310insAGGGp.D104fs--Ruzzo2019 G
TSNARE1     iHART2244chr8:
143425762-143425762
CCCCCTexonicPaternalframeshift insertionNM_145003c.309_310insAGGGp.D104fs--Ruzzo2019 G
TSNARE1     2-1366-003chr8:
143445238-143445238
CTintronicDe novo--Yuen2017 G
TSNARE1     2-1391-003chr8:
143494773-143494773
AACintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More