
Results for "GRIN2B"

Variant Events: 171

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
GRIN2B     AU3847302chr12:
GCintergenicDe novo--Yuen2017 G
GRIN2B     1-0486-003chr12:
GAintronicDe novo--Trost2022 G
Yuen2017 G
GRIN2B     HEN0197.p1chr12:
TCexonicMaternalnonsynonymous SNVNM_000834c.A998Gp.N333S10.571.647E-5Guo2018 T
GRIN2B     SJD_15.3chr12:
AGexonicDe novosynonymous SNVNM_000834c.T4410Cp.N1470N-2.471E-5Trost2022 G
Zhou2022 GE
GRIN2B     2-0202-004chr12:
GGTTCATTTTintergenicDe novo--Yuen2017 G
GRIN2B     SD0032.p1chr12:
GAexonicMaternalnonsynonymous SNVNM_000834c.C4004Tp.P1335L15.08-Guo2018 T
GRIN2B     SP0045624chr12:
AGTGGGGAACTCCGCAGGCACTAexonicnonframeshift deletionNM_000834c.804_824delp.268_275del--Zhou2022 GE
GRIN2B     HEN0101.p1chr12:
TCexonicMaternalnonsynonymous SNVNM_000834c.A4342Gp.I1448V10.7-Guo2018 T
GRIN2B     SMHC01859s000chr12:
TCexonicDe novononsynonymous SNVNM_000834c.A1427Gp.Y476C23.9-Yuan2023 E
GRIN2B     2-1540-003chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G2515Ap.E839K36.0-Trost2022 G
Zhou2022 GE
GRIN2B     AU058104chr12:
CTintronicDe novo--Trost2022 G
Yuen2017 G
GRIN2B     1-0395-004chr12:
TCintergenicDe novo--Yuen2017 G
GRIN2B     G01-GEA-67-HIchr12:
CTexonicDe novononsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Fu2022 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
GRIN2B     1-0412-003chr12:
ATintergenicDe novo--Yuen2017 G
GRIN2B     Husson2020:136chr12:
AAGexonicframeshift insertionNM_000834c.23_24insCp.C8fs--Husson2020 E
GRIN2B     M12312chr12:
CTexonicMaternalnonsynonymous SNVNM_000834c.G3118Ap.G1040S16.141.649E-5Guo2018 T
Wang2016 T
GRIN2B     AU030703chr12:
CAexonicUnknownnonsynonymous SNVNM_000834c.G286Tp.G96W24.5-Stessman2017 T
GRIN2B     AU4306302chr12:
GAintergenicDe novo--Yuen2017 G
GRIN2B     M12487chr12:
GAexonicPaternalnonsynonymous SNVNM_000834c.C3683Tp.T1228M0.2513.298E-5Guo2018 T
Wang2016 T
GRIN2B     M17613chr12:
GAexonicPaternalnonsynonymous SNVNM_000834c.C3683Tp.T1228M0.2513.298E-5Guo2018 T
Wang2016 T
GRIN2B     AU3853302chr12:
GAintronicDe novo--Trost2022 G
Yuen2017 G
GRIN2B     G01-GEA-123-HIchr12:
GCexonicDe novostopgainNM_000834c.C2607Gp.Y869X41.0-Fu2022 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
GRIN2B     7-0167-003chr12:
TCintronicDe novo--Trost2022 G
Yuen2017 G
GRIN2B     SAGE_BK789-01chr12:
GAexonicDe novononsynonymous SNVNM_000834c.C2060Tp.P687L34.0-Wang2020 T
GRIN2B     12681_p1chr12:
TCsplicingDe novosplicing17.06-Fu2022 E
GRIN2B     M16260chr12:
CAexonicMaternalnonsynonymous SNVNM_000834c.G4318Tp.A1440S0.8958.239E-6Guo2018 T
Wang2016 T
GRIN2B     1-0162-004chr12:
AGintergenicDe novo--Yuen2017 G
GRIN2B     A27chr12:
TGintergenicDe novo--Wu2018 G
GRIN2B     M8862chr12:
TCexonicUnknownnonsynonymous SNVNM_000834c.A4015Gp.M1339V11.19-Wang2016 T
GRIN2B     1-0214-003chr12:
GAupstreamDe novo--Trost2022 G
Yuen2017 G
GRIN2B     ACGC_M20277chr12:
GAexonicDe novostopgainNM_000834c.C1555Tp.R519X40.08.24E-6Wang2020 T
GRIN2B     1-0534-006chr12:
ACintergenicDe novo--Yuen2017 G
GRIN2B     05C44735chr12:
GAexonicDe novostopgainNM_000834c.C1555Tp.R519X40.08.24E-6Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
GRIN2B     HEN0293.p1chr12:
GCexonicPaternalnonsynonymous SNVNM_000834c.C1783Gp.P595A15.918.298E-6Guo2018 T
GRIN2B     JS0047.p1chr12:
TCexonicPaternalnonsynonymous SNVNM_000834c.A4015Gp.M1339V11.19-Guo2018 T
GRIN2B     Yamamoto2019:11chr12:
TCexonicDe novononsynonymous SNVNM_000834c.A2450Gp.N817S26.4-Yamamoto2019 T
GRIN2B     HEN0329.p1chr12:
TCexonicPaternalnonsynonymous SNVNM_000834c.A998Gp.N333S10.571.647E-5Guo2018 T
GRIN2B     5-0073-003chr12:
CTintergenicDe novo--Yuen2017 G
GRIN2B     2-1620-003chr12:
CTATGATCintergenicDe novo--Yuen2017 G
GRIN2B     M12425chr12:
CTexonicMaternal, Unknownnonsynonymous SNVNM_000834c.G3505Ap.G1169R11.843.301E-5Guo2018 T
Wang2016 T
GRIN2B     1-0494-003chr12:
TCintergenicDe novo--Yuen2017 G
GRIN2B     HN0099.p1chr12:
GAexonicPaternalnonsynonymous SNVNM_000834c.C764Tp.T255M19.168.242E-6Guo2018 T
GRIN2B     1-0986-003chr12:
TCintergenicDe novo--Yuen2017 G
GRIN2B     GX0024.p1chr12:
GTexonicPaternalnonsynonymous SNVNM_000834c.C3111Ap.D1037E10.961.648E-5Guo2018 T
GRIN2B     GX0485.p1chr12:
TCexonicPaternalnonsynonymous SNVNM_000834c.A1022Gp.N341S23.5-Guo2018 T
GRIN2B     GX0394.p1chr12:
GTexonicPaternalnonsynonymous SNVNM_000834c.C3111Ap.D1037E10.961.648E-5Guo2018 T
GRIN2B     SAGE_559.03chr12:
TCsplicingDe novosplicing17.06-Wang2020 T
GRIN2B     SP0017489chr12:
TGintronicDe novo--Fu2022 E
GRIN2B     SP0109367chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G2791Ap.V931I0.198-Fu2022 E
Trost2022 G
Zhou2022 GE
GRIN2B     12681.p1chr12:
TCsplicingDe novosplicing17.06-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Trost2022 G
Wang2020 T
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
GRIN2B     12547.p1chr12:
CTexonicDe novostopgainNM_000834c.G1677Ap.W559X41.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Willsey2013 E
Zhou2022 GE
GRIN2B     SP0048255chr12:
GAexonicDe novononsynonymous SNVNM_000834c.C3895Tp.R1299C15.04-Fu2022 E
Trost2022 G
Zhou2022 GE
GRIN2B     13932.p1chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G1367Ap.C456Y27.6-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Zhou2022 GE
GRIN2B     11540.p1chr12:
CTintronicMosaic--Dou2017 E
GRIN2B     SP0142921chr12:
CGsplicingDe novosplicing26.5-Fu2022 E
Zhou2022 GE
GRIN2B     11691.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_000834
-2.0E-4Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
GRIN2B     2-0013-003chr12:
GAintergenicDe novo--Yuen2017 G
GRIN2B     M20615chr12:
CTexonicPaternalnonsynonymous SNVNM_000834c.G1198Ap.E400K13.8-Guo2018 T
Wang2016 T
GRIN2B     M20277chr12:
GAexonicDe novostopgainNM_000834c.C1555Tp.R519X40.08.24E-6Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
GRIN2B     SAGE_BK787-01chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Wang2020 T
GRIN2B     AU3951301chr12:
AAGAAAGAGintergenicDe novo--Yuen2017 G
GRIN2B     B9M7Fchr12:
CTexonicUnknownnonsynonymous SNVNM_000834c.G1037Ap.G346E29.1-Stessman2017 T
GRIN2B     ACGC_SX0065.p1chr12:
CTexonicUnknownnonsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Wang2020 T
GRIN2B     SP0017047chr12:
GAexonicDe novosynonymous SNVNM_000834c.C2731Tp.L911L--Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
GRIN2B     08C77366chr12:
CGexonicDe novononsynonymous SNVNM_000834c.G1460Cp.G487A32.0-Stessman2017 T
GRIN2B     5-0025-004chr12:
TCintergenicDe novo--Yuen2017 G
GRIN2B     2-0307-003chr12:
TCintronicDe novo--Trost2022 G
Yuen2017 G
GRIN2B     Mahjani2021:35chr12:
CCTGATexonicframeshift insertionNM_000834c.2593_2594insATCAp.S865fs--Mahjani2021 E
GRIN2B     2-1508-003chr12:
AGintergenicDe novo--Yuen2017 G
GRIN2B     Mahjani2021:36chr12:
TTCATTCTTCTCAexonicframeshift insertionNM_000834c.2419_2420insTGAGAAGAATGp.E807fs--Mahjani2021 E
GRIN2B     SSC05465chr12:
TCsplicingDe novosplicing17.06-Antaki2022 GE
Chan2022 G
GRIN2B     Mahjani2021:46chr12:
GAexonicnonsynonymous SNVNM_000834c.C2044Tp.R682C34.0-Mahjani2021 E
GRIN2B     SP0010540chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G2002Ap.D668N34.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
GRIN2B     SP0070933chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G2056Ap.V686M33.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
GRIN2B     M21987chr12:
GCexonicUnknown, Paternalnonsynonymous SNVNM_000834c.C2835Gp.D945E16.28-Guo2018 T
Wang2016 T
GRIN2B     Mahjani2021:41chr12:
CTexonicnonsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Mahjani2021 E
GRIN2B     mAGRE5751chr12:
CGexonicDe novononsynonymous SNVNM_000834c.G1460Cp.G487A32.0-Cirnigliaro2023 G
GRIN2B     1-0651-003chr12:
CTintergenicDe novo--Yuen2017 G
GRIN2B     Mahjani2021:48chr12:
CTexonicstopgainNM_000834c.G1136Ap.W379X40.0-Mahjani2021 E
GRIN2B     SP0059887chr12:
GTexonicDe novostopgainNM_000834c.C1437Ap.Y479X40.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
GRIN2B     Mahjani2021:47chr12:
CTexonicnonsynonymous SNVNM_000834c.G1619Ap.R540H29.6-Mahjani2021 E
GRIN2B     SSC06040chr12:
CTexonicDe novostopgainNM_000834c.G1677Ap.W559X41.0-Antaki2022 GE
Chan2022 G
Fu2022 E
Trost2022 G
GRIN2B     SSC02952chr12:
TTGexonicframeshift insertionNM_000834c.99dupCp.S34fs-2.0E-4Antaki2022 GE
GRIN2B     SSC10172chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G1367Ap.C456Y27.6-Antaki2022 GE
Trost2022 G
GRIN2B     Leuven2_66295205chr12:
TCATexonicUnknownframeshift deletionNM_000834c.2862_2863delp.C954fs--Wang2020 T
GRIN2B     Leuven_150281chr12:
CTsplicingUnknownsplicing22.9-Wang2020 T
GRIN2B     M12406chr12:
GTexonicMaternalnonsynonymous SNVNM_000834c.C94Ap.P32T12.42-Guo2018 T
Wang2016 T
GRIN2B     Leuven_73101263chr12:
AACATTGTGACAAATGCCAexonicUnknownframeshift insertionNM_000834c.2393_2394insTGGCATTTGTCACAATGp.T798fs--Wang2020 T
GRIN2B     GX0019.p1chr12:
GAexonicMaternalnonsynonymous SNVNM_000834c.C28Tp.P10S14.61-Guo2018 T
GRIN2B     Leuven_185718chr12:
CTsplicingUnknownsplicing34.0-Wang2020 T
GRIN2B     Leuven_74764077chr12:
CTexonicUnknownnonsynonymous SNVNM_000834c.G1570Ap.D524N36.0-Wang2020 T
GRIN2B     12175.p1chr12:
GTintergenicDe novo--Turner2016 G
GRIN2B     13298.p1chr12:
GAintronicDe novo--Turner2016 G
GRIN2B     12175.p1chr12:
TGintergenicDe novo--Turner2016 G
GRIN2B     1-0395-003chr12:
TCintergenicDe novo--Yuen2017 G
GRIN2B     1-0539-003chr12:
TCintronicDe novo--Trost2022 G
Yuen2017 G
GRIN2B     SAGE_BK_662_01chr12:
CAexonicUnknownnonsynonymous SNVNM_000834c.G2002Tp.D668Y25.3-Wang2020 T
GRIN2B     AGRE_AU030703chr12:
CAexonicUnknownnonsynonymous SNVNM_000834c.G286Tp.G96W24.5-Wang2020 T
GRIN2B     Greenwood_Cms23857chr12:
CTexonicUnknownnonsynonymous SNVNM_000834c.G1556Ap.R519Q37.0-Wang2020 T
GRIN2B     ACGC_GD0231.p1chr12:
CTexonicUnknownnonsynonymous SNVNM_000834c.G1619Ap.R540H29.6-Wang2020 T
GRIN2B     BRK-77–01chr12:
AGexonicDe novononsynonymous SNVNM_000834c.T1246Cp.F416L34.0-Abdi2023 G
GRIN2B     AGRE_04C24300chr12:
CAexonicUnknownnonsynonymous SNVNM_000834c.G286Tp.G96W24.5-Wang2020 T
GRIN2B     Leuven2_73101263chr12:
TTCATTGTGACAAATGCCAexonicUnknownframeshift insertionNM_000834c.2410_2411insTGGCATTTGTCACAATGp.E804fs--Wang2020 T
GRIN2B     2-1444-003chr12:
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
GRIN2B     04C24300chr12:
CAexonicUnknownnonsynonymous SNVNM_000834c.G286Tp.G96W24.5-Stessman2017 T
GRIN2B     SanDiego_B9M7Fchr12:
CTexonicUnknownnonsynonymous SNVNM_000834c.G1037Ap.G346E29.1-Wang2020 T
GRIN2B     SAGE_549.03chr12:
CTexonicUnknownnonsynonymous SNVNM_000834c.G1367Ap.C456Y27.6-Wang2020 T
GRIN2B     SAGE_BK_642.01chr12:
CTexonicUnknownstopgainNM_000834c.G3437Ap.W1146X41.0-Wang2020 T
GRIN2B     150281chr12:
CTsplicingInheritedsplicing22.9-Stessman2017 T
GRIN2B     SP0237868chr12:
GAexonicstopgainNM_000834c.C538Tp.Q180X39.0-Zhou2022 GE
GRIN2B     AU047703chr12:
GAintronicDe novo--Trost2022 G
Yuen2017 G
GRIN2B     SP0352072chr12:
CTexonicnonsynonymous SNVNM_000834c.G1556Ap.R519Q37.0-Zhou2022 GE
GRIN2B     AU3692302chr12:
CAintergenicDe novo--Yuen2017 G
GRIN2B     SP0177846chr12:
CTexonicnonsynonymous SNVNM_000834c.G2377Ap.E793K33.0-Zhou2022 GE
GRIN2B     Kenny2014:6chr12:
GAexonicUnknownstopgainNM_000834c.C2131Tp.Q711X42.0-Kenny2014 T
GRIN2B     M16114chr12:
GAexonicMaternalnonsynonymous SNVNM_000834c.C4270Tp.L1424F8.6862.476E-5Guo2018 T
Wang2016 T
GRIN2B     SP0264509chr12:
CTexonicnonsynonymous SNVNM_000834c.G3766Ap.E1256K22.2-Zhou2022 GE
GRIN2B     SP0157716chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G1837Ap.V613M29.1-Trost2022 G
Zhou2022 GE
GRIN2B     185718chr12:
CTsplicingInheritedsplicing34.0-Stessman2017 T
GRIN2B     SP0320116chr12:
CTexonicnonsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Zhou2022 GE
GRIN2B     M15056chr12:
GAexonicMaternalnonsynonymous SNVNM_000834c.C4256Tp.P1419L14.848.26E-6Guo2018 T
Wang2016 T
GRIN2B     M3803chr12:
AGexonicMaternalnonsynonymous SNVNM_000834c.T4016Cp.M1339T12.0-Wang2016 T
GRIN2B     2-1485-003chr12:
AGintergenicDe novo--Yuen2017 G
GRIN2B     ASD046chr12:
TTCexonicDe novoframeshift insertionNM_000834c.2208dupGp.N737fs--Tran2020 E
Wu2019 E
GRIN2B     MAC880chr12:
CTexonicDe novononsynonymous SNVNM_000834c.G695Ap.C232Y21.8-Fu2022 E
GRIN2B     7-0456-003chr12:
AGintronicDe novo--Trost2022 G
GRIN2B     A1334Bchr12:
TTGexonicDe novoframeshift insertionNM_000834c.99dupCp.S34fs-2.0E-4Fu2022 E
GRIN2B     AU2283301chr12:
GTintronicDe novo--Trost2022 G
GRIN2B     7-0048-003chr12:
CTintronicDe novo--Trost2022 G
GRIN2B     AU2604301chr12:
TAintronicDe novo--Trost2022 G
GRIN2B     MT_31.3chr12:
GAintronicDe novo--Trost2022 G
GRIN2B     A21chr12:
CTintergenicDe novo--Wu2018 G
GRIN2B     7-0388-003chr12:
CTintronicDe novo--Trost2022 G
GRIN2B     5902chr12:
TTGexonicDe novoframeshift insertionNM_000834c.99dupCp.S34fs-2.0E-4Fu2022 E
GRIN2B     MSSNG00361-004chr12:
CTintronicDe novo--Trost2022 G
GRIN2B     10-1104-004chr12:
GAintronicDe novo--Trost2022 G
GRIN2B     SF0059887.p1chr12:
GTexonicstopgainNM_000834c.C1437Ap.Y479X40.0-Wang2020 T
GRIN2B     2-1790-003chr12:
CGintronicDe novo--Trost2022 G
GRIN2B     SF0010540.p1chr12:
CTexonicnonsynonymous SNVNM_000834c.G2002Ap.D668N34.0-Wang2020 T
GRIN2B     5-0086-003chr12:
AGintronicDe novo--Trost2022 G
GRIN2B     MSSNG00030-003chr12:
GAintronicDe novo--Trost2022 G
GRIN2B     3-0607-001chr12:
CGintronicDe novo--Trost2022 G
GRIN2B     SF0109366.p2chr12:
CTexonicnonsynonymous SNVNM_000834c.G2791Ap.V931I0.198-Wang2020 T
GRIN2B     7-0199-003chr12:
TCintronicDe novo--Trost2022 G
GRIN2B     SF0048255.p1chr12:
GAexonicnonsynonymous SNVNM_000834c.C3895Tp.R1299C15.04-Wang2020 T
GRIN2B     AU2729301chr12:
TCintronicDe novo--Trost2022 G
GRIN2B     2-1416-004chr12:
CAintergenicDe novo--Yuen2017 G
GRIN2B     SF0142921.p1chr12:
CGsplicingsplicing26.5-Wang2020 T
GRIN2B     1-0319-003chr12:
GCintronicDe novo--Trost2022 G
GRIN2B     SF0070933.p1chr12:
CTexonicnonsynonymous SNVNM_000834c.G2056Ap.V686M33.0-Wang2020 T
GRIN2B     REACH000293chr12:
GAintronicDe novo--Trost2022 G
GRIN2B     REACH000182chr12:
CTACintronicDe novo--Trost2022 G
GRIN2B     5-5057-003chr12:
CTintronicDe novo--Trost2022 G
GRIN2B     1-0186-004chr12:
TGintronicDe novo--Trost2022 G
GRIN2B     AU3881301chr12:
CTintergenicDe novo--Yuen2017 G
GRIN2B     AU2463301chr12:
GAintronicDe novo--Trost2022 G
GRIN2B     216-4499-1chr12:
ACexonicDe novononsynonymous SNVNM_000834c.T1573Gp.F525V32.0-O’Roak2014 T
GRIN2B     2-1546-003chr12:
TGintronicDe novo--Trost2022 G
GRIN2B     1-0186-004chr12:
CTGTGGACAintronicDe novo--Trost2022 G
GRIN2B     M08862chr12:
TCexonicPaternalnonsynonymous SNVNM_000834c.A4015Gp.M1339V11.19-Guo2018 T
GRIN2B     REACH000589chr12:
CAintronicDe novo--Trost2022 G
GRIN2B     25chr12:
GAexonicDe novononsynonymous SNVNM_000834c.C1658Tp.P553L19.92-O’Roak2014 T
GRIN2B     5-0068-003chr12:
GAintronicDe novo--Trost2022 G
GRIN2B     5-5057-003chr12:
AGintronicDe novo--Trost2022 G
GRIN2B     AU3881301chr12:
GAintergenicDe novo--Yuen2017 G
GRIN2B     MSSNG00434-003chr12:
GAintronicDe novo--Trost2022 G
GRIN2B     2-1297-004chr12:
GTintergenicDe novo--Yuen2017 G
GRIN2B     2-1592-003chr12:
GAGintronicDe novo--Trost2022 G
GRIN2B     Stessman2017:ASD_1032-1chr12:
TAGATGTCTAGATGTTAGATGTCexonicInheritedstopgainNM_000834c.3464_3465insACATCTAp.Y1155_K1156delinsX--Stessman2017 T
GRIN2B     4-0073-003chr12:
CTGAintronicDe novo--Trost2022 G
GRIN2B     7-0189-003chr12:
CTintronicDe novo--Trost2022 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView