
Results for "SPG7"

Variant Events: 11

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
SPG7     iHART2962chr16:
CTCexonicMaternalframeshift deletionNM_003119c.2195delTp.L732fs--Ruzzo2019 G
SPG7     200675453@1082034446chr16:
CTexonicDe novononsynonymous SNVNM_003119c.C1456Tp.R486W19.735.19E-5Satterstrom2020 E
SPG7     SP0125708chr16:
AGexonicDe novononsynonymous SNVNM_003119
4.625-Fu2022 E
SPG7     SP0132441chr16:
CTexonicDe novosynonymous SNVNM_003119
-8.276E-6Fu2022 E
SPG7     1-0213-004chr16:
CTintronicDe novo--Yuen2017 G
SPG7     iHART1972chr16:
CGGCCCCCCCGGCTGTGGGAAGACGCTGCTCexonicMaternalframeshift deletionNM_003119
-8.307E-6Ruzzo2019 G
SPG7     Chen2017:44chr16:
CTexonicDe novononsynonymous SNVNM_003119c.C1456Tp.R486W19.735.19E-5Chen2017 E
SPG7     2-1382-003chr16:
AGintronicDe novo--Yuen2017 G
SPG7     12349.p1chr16:
GAintronicMosaic-8.246E-6Dou2017 E
SPG7     11550-1chr16:
GAexonicDe novononsynonymous SNVNM_003119
11.571.735E-5Fu2022 E
SPG7     200675453_1082034446chr16:
CTexonicDe novononsynonymous SNVNM_003119c.C1456Tp.R486W19.735.19E-5Fu2022 E
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView