or
or
Exact

Results for "MED12"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MED12     3-0610-000chrX:
70345325-70345325
GAexonicDe novononsynonymous SNVNM_005120c.G2351Ap.R784H19.61.164E-5Chan2022 G
MED12     13672.p1chrX:
70352976-70352976
GTexonicMosaicnonsynonymous SNVNM_005120c.G4531Tp.V1511L8.111-Dou2017 E
MED12     Yalcintepe2021:8chrX:
70357201-70357201
CGexonicnonsynonymous SNVNM_005120c.C5716Gp.P1906A9.35-Yalcintepe2021 T
MED12     NDAR_INVMZ771GPL_wes1chrX:
70345918-70345918
CTexonicDe novononsynonymous SNVNM_005120c.C2455Tp.R819W17.391.148E-5Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
MED12     08C78223chrX:
70351434-70351434
TCexonicDe novononsynonymous SNVNM_005120c.T4082Cp.L1361S16.21-Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
MED12     Alvarez-Mora2016:ASD-22chrX:
70361148-70361151
ACAAACAACAACAACATCAAexonicDe novononframeshift insertionNM_005120c.6339_6340insCAACAACATCAAp.Q2113delinsQQQHQ--Alvarez-Mora2016 T
MED12     A10chrX:
70339271-70339271
GTexonicDe novononsynonymous SNVNM_005120c.G148Tp.A50S17.16-Wu2018 G
MED12     Yalcintepe2021:4chrX:
70346204-70346204
TGexonicDe novononsynonymous SNVNM_005120c.T2555Gp.V852G17.14-Yalcintepe2021 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More