or
or
Exact

Results for "NTN1"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NTN1     AU054303chr17:
9032655-9032655
GTintronicDe novo--Yuen2017 G
NTN1     2-1338-003chr17:
8956834-8956834
CTintronicDe novo--Yuen2017 G
NTN1     2-0002-005chr17:
9139930-9139930
AGintronicDe novo--Yuen2017 G
NTN1     2-1251-003chr17:
9089418-9089418
GAintronicDe novo--Yuen2017 G
NTN1     JASD_Fam0095chr17:
9143210-9143210
GAexonicDe novosynonymous SNVNM_004822c.G1740Ap.Q580Q--Takata2018 E
NTN1     2-1252-003chr17:
8961118-8961118
AGintronicDe novo--Yuen2017 G
NTN1     1-0546-003chr17:
8928168-8928182
CAGAGAGAGAGAGAGCAGAGAGAGAGAGintronicDe novo--Yuen2017 G
NTN1     2-0285-004chr17:
9069390-9069390
CTintronicDe novo--Yuen2017 G
NTN1     2-0713-003chr17:
9152744-9152744
CGintergenicDe novo--Yuen2017 G
NTN1     13717.p1chr17:
9083262-9083262
CAexonicDe novononsynonymous SNVNM_004822c.C1346Ap.A449D32.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
NTN1     1-0277-003chr17:
9041498-9041498
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NTN1     2-1434-003chr17:
8997461-8997462
ACAintronicDe novo--Yuen2016 G
Yuen2017 G
NTN1     1-0171-005chr17:
9132241-9132241
GGACTGTAAGTGTGACTGTGTGAGACintronicDe novo--Yuen2017 G
NTN1     AU3052302chr17:
8956245-8956245
AGintronicDe novo--Yuen2017 G
NTN1     5-0041-003chr17:
9117367-9117367
CTintronicDe novo--Yuen2017 G
NTN1     2-1089-003chr17:
8994242-8994242
CAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More