or
or
Exact

Results for "HMCN1"

Variant Events: 21

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HMCN1     A18chr1:
185882429-185882429
GAintronicDe novo--Wu2018 G
HMCN1     2-0070-004chr1:
185962160-185962160
TCintronicDe novo--Yuen2017 G
HMCN1     ASC_CA_65_Achr1:
186057403-186057403
GAexonicDe novononsynonymous SNVNM_031935c.G9572Ap.R3191H8.2844.985E-5Satterstrom2020 E
HMCN1     1-0699-003chr1:
185974563-185974581
TAATTGTTTAAATTGTTTATAATTGTTTAintronicDe novo--Yuen2017 G
HMCN1     1-0652-004chr1:
185729516-185729516
CTintronicDe novo--Yuen2017 G
HMCN1     AU3790301chr1:
185938314-185938314
CAintronicDe novo--Yuen2017 G
HMCN1     Lim2017:6239chr1:
185984388-185984388
GCexonicDe novononsynonymous SNVNM_031935c.G4728Cp.M1576I11.22-Lim2017 E
HMCN1     11002.p1chr1:
185871744-185871744
AGintronicDe novo--Turner2016 G
HMCN1     iHART2618chr1:
186099234-186099234
TGsplicingMaternalsplicing23.38.262E-6Ruzzo2019 G
HMCN1     AC02-1240-01chr1:
185985113-185985113
TCexonicDe novosynonymous SNVNM_031935c.T4933Cp.L1645L-8.261E-6DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
HMCN1     AU034903chr1:
185857762-185857762
GAintronicDe novo--Yuen2017 G
HMCN1     1-0465-003achr1:
185915693-185915693
TAintronicDe novo--Yuen2017 G
HMCN1     AU3636301chr1:
185870438-185870438
TGintronicDe novo--Yuen2017 G
HMCN1     12478.p1chr1:
185833720-185833720
CTexonicMosaic, De novononsynonymous SNVNM_031935c.C458Tp.T153I23.48.302E-6Dou2017 E
Ji2016 E
Krumm2015 E
Krupp2017 E
HMCN1     2-1434-003chr1:
185737010-185737010
GCintronicDe novo--Yuen2016 G
Yuen2017 G
HMCN1     2-1374-003chr1:
185718850-185718850
GCintronicDe novo--Yuen2017 G
HMCN1     AU076705chr1:
185725128-185725128
CGintronicDe novo--Yuen2017 G
HMCN1     AU4150301chr1:
185840780-185840780
AGintronicDe novo--Yuen2017 G
HMCN1     SP0042538chr1:
186084456-186084456
CTexonicDe novononsynonymous SNVNM_031935c.C11471Tp.A3824V26.9-Feliciano2019 E
HMCN1     1675002chr1:
186055470-186055470
CTexonicDe novononsynonymous SNVNM_031935c.C8977Tp.P2993S18.392.48E-5Satterstrom2020 E
HMCN1     1-0567-003chr1:
185988492-185988492
ACintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More