or
or
Exact

Results for "DYSF"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DYSF     3-0428-000chr2:
71845645-71845645
TGintronicDe novo--Yuen2017 G
DYSF     AU1725302chr2:
71875171-71875171
GAintronicDe novo--Yuen2017 G
DYSF     14311.p1chr2:
71839829-71839829
GAexonicDe novononsynonymous SNVNM_001130976
NM_001130977
NM_001130984
NM_001130986
NM_001130455
NM_001130978
NM_001130980
NM_001130981
NM_001130983
NM_001130985
NM_001130987
NM_003494
NM_001130979
NM_001130982
c.G4184A
c.G4184A
c.G4187A
c.G4187A
c.G4229A
c.G4226A
c.G4277A
c.G4277A
c.G4229A
c.G4280A
c.G4280A
c.G4226A
c.G4319A
c.G4322A
p.R1395H
p.R1395H
p.R1396H
p.R1396H
p.R1410H
p.R1409H
p.R1426H
p.R1426H
p.R1410H
p.R1427H
p.R1427H
p.R1409H
p.R1440H
p.R1441H
33.01.651E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
DYSF     2-0215-003chr2:
72119463-72119464
TGTintergenicDe novo--Yuen2017 G
DYSF     2-1389-003chr2:
72204868-72204868
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
DYSF     7-0191-003chr2:
72120672-72120672
CTintergenicDe novo--Yuen2017 G
DYSF     2-1509-003chr2:
72300311-72300314
GGTGGGintergenicDe novo--Yuen2017 G
DYSF     2-0144-003chr2:
72299836-72299836
TTATCintergenicDe novo--Yuen2017 G
DYSF     13171.p1chr2:
72114182-72114185
ACTTAintergenicDe novo--Werling2018 G
DYSF     2-1407-003chr2:
72103478-72103478
CTintergenicDe novo--Yuen2017 G
DYSF     AU3808305chr2:
71996871-71996871
TCintergenicDe novo--Yuen2017 G
DYSF     2-0182-003chr2:
72250336-72250336
CAintergenicDe novo--Yuen2017 G
DYSF     iHART2458chr2:
71871118-71871118
GAexonicMaternalstopgainNM_001130976
NM_001130986
NM_001130455
NM_001130977
NM_001130980
NM_001130984
NM_001130985
NM_003494
NM_001130978
NM_001130979
NM_001130981
NM_001130982
NM_001130983
NM_001130987
c.G4392A
c.G4395A
c.G4437A
c.G4455A
c.G4485A
c.G4458A
c.G4488A
c.G4434A
c.G4497A
c.G4527A
c.G4548A
c.G4530A
c.G4500A
c.G4551A
p.W1464X
p.W1465X
p.W1479X
p.W1485X
p.W1495X
p.W1486X
p.W1496X
p.W1478X
p.W1499X
p.W1509X
p.W1516X
p.W1510X
p.W1500X
p.W1517X
46.01.143E-5Ruzzo2019 G
DYSF     ASDFI_1061chr2:
71788955-71788955
CTexonicDe novononsynonymous SNVNM_001130976
NM_001130977
NM_001130984
NM_001130986
NM_001130455
NM_001130978
NM_001130980
NM_001130981
NM_001130983
NM_001130985
NM_001130987
NM_003494
NM_001130979
NM_001130982
c.C2194T
c.C2194T
c.C2197T
c.C2197T
c.C2239T
c.C2236T
c.C2287T
c.C2287T
c.C2239T
c.C2290T
c.C2290T
c.C2236T
c.C2329T
c.C2332T
p.H732Y
p.H732Y
p.H733Y
p.H733Y
p.H747Y
p.H746Y
p.H763Y
p.H763Y
p.H747Y
p.H764Y
p.H764Y
p.H746Y
p.H777Y
p.H778Y
12.08-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
DYSF     DEASD_0147_001chr2:
71797809-71797809
CTexonicDe novostopgainNM_001130976
NM_001130977
NM_001130984
NM_001130986
NM_001130455
NM_001130978
NM_001130980
NM_001130981
NM_001130983
NM_001130985
NM_001130987
NM_003494
NM_001130979
NM_001130982
c.C3070T
c.C3070T
c.C3073T
c.C3073T
c.C3115T
c.C3112T
c.C3163T
c.C3163T
c.C3115T
c.C3166T
c.C3166T
c.C3112T
c.C3205T
c.C3208T
p.R1024X
p.R1024X
p.R1025X
p.R1025X
p.R1039X
p.R1038X
p.R1055X
p.R1055X
p.R1039X
p.R1056X
p.R1056X
p.R1038X
p.R1069X
p.R1070X
44.01.679E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
DYSF     2-0016-003chr2:
71854444-71854444
GAintronicDe novo--Yuen2017 G
DYSF     AU3874302chr2:
71956539-71956543
ACTCTACTintergenicDe novo--Yuen2017 G
DYSF     iHART2459chr2:
71871118-71871118
GAexonicMaternalstopgainNM_001130976
NM_001130986
NM_001130455
NM_001130977
NM_001130980
NM_001130984
NM_001130985
NM_003494
NM_001130978
NM_001130979
NM_001130981
NM_001130982
NM_001130983
NM_001130987
c.G4392A
c.G4395A
c.G4437A
c.G4455A
c.G4485A
c.G4458A
c.G4488A
c.G4434A
c.G4497A
c.G4527A
c.G4548A
c.G4530A
c.G4500A
c.G4551A
p.W1464X
p.W1465X
p.W1479X
p.W1485X
p.W1495X
p.W1486X
p.W1496X
p.W1478X
p.W1499X
p.W1509X
p.W1516X
p.W1510X
p.W1500X
p.W1517X
46.01.143E-5Ruzzo2019 G
DYSF     1-0296-004chr2:
71904750-71904750
GCintronicDe novo--Yuen2017 G
DYSF     iHART2397chr2:
71797727-71797727
AGsplicingPaternalsplicing7.648-Ruzzo2019 G
DYSF     1-0320-004chr2:
71940140-71940142
CATCintergenicDe novo--Yuen2017 G
DYSF     2-1283-003chr2:
72076923-72076925
TGATintergenicDe novo--Yuen2017 G
DYSF     12175.p1chr2:
72036419-72036419
AGintergenicDe novo--Turner2016 G
DYSF     5-0033-004chr2:
72129010-72129015
ACAGCTAintergenicDe novo--Yuen2017 G
DYSF     MR432chr2:
71839871-71839871
GAexonicDe novononsynonymous SNVNM_001130976
NM_001130977
NM_001130984
NM_001130986
NM_001130455
NM_001130978
NM_001130980
NM_001130981
NM_001130983
NM_001130985
NM_001130987
NM_003494
NM_001130979
NM_001130982
c.G4226A
c.G4226A
c.G4229A
c.G4229A
c.G4271A
c.G4268A
c.G4319A
c.G4319A
c.G4271A
c.G4322A
c.G4322A
c.G4268A
c.G4361A
c.G4364A
p.R1409H
p.R1409H
p.R1410H
p.R1410H
p.R1424H
p.R1423H
p.R1440H
p.R1440H
p.R1424H
p.R1441H
p.R1441H
p.R1423H
p.R1454H
p.R1455H
13.748.261E-6Satterstrom2020 E
DYSF     1-0402-004chr2:
72033937-72033937
GCintergenicDe novo--Yuen2017 G
DYSF     A11chr2:
72057557-72057557
GAintergenicDe novo--Wu2018 G
DYSF     2-0036-003chr2:
71854444-71854444
GAintronicDe novo--Yuen2016 G
DYSF     AU4372309chr2:
72177301-72177301
TAintergenicDe novo--Yuen2017 G
DYSF     1-0488-003chr2:
71766338-71766338
GAexonicDe novosynonymous SNVNM_001130455
NM_001130976
NM_001130977
NM_001130978
NM_001130983
NM_001130984
NM_001130986
NM_003494
NM_001130979
NM_001130980
NM_001130981
NM_001130982
NM_001130985
NM_001130987
c.G1452A
c.G1449A
c.G1449A
c.G1449A
c.G1452A
c.G1452A
c.G1452A
c.G1449A
c.G1542A
c.G1542A
c.G1542A
c.G1545A
c.G1545A
c.G1545A
p.S484S
p.S483S
p.S483S
p.S483S
p.S484S
p.S484S
p.S484S
p.S483S
p.S514S
p.S514S
p.S514S
p.S515S
p.S515S
p.S515S
-1.647E-5Yuen2017 G
DYSF     3-0436-000chr2:
71694933-71694949
GATAATAATAATAATAAGATAATAATAATAAintronicDe novo--Yuen2017 G
DYSF     1-0289-003chr2:
71785386-71785387
CTCintronicDe novo--Yuen2017 G
DYSF     2-1290-003chr2:
72051860-72051860
GTintergenicDe novo--Yuen2017 G
DYSF     AU3724302chr2:
72289569-72289569
CTintergenicDe novo--Yuen2017 G
DYSF     2-1283-004chr2:
72076923-72076925
TGATintergenicDe novo--Yuen2017 G
DYSF     AU3053301chr2:
72279519-72279519
TGintergenicDe novo--Yuen2017 G
DYSF     2-1529-003chr2:
72081856-72081856
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More