or
or
Exact

Results for "DPYSL5"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DPYSL5     1-0347-003chr2:
27074847-27074847
AGintronicDe novo--Yuen2017 G
DPYSL5     PN400350chr2:
27121458-27121458
GAexonicUnknownnonsynonymous SNVNM_001253723
NM_001253724
NM_020134
c.G91A
c.G91A
c.G91A
p.E31K
p.E31K
p.E31K
34.01.647E-5Leblond2019 E
DPYSL5     2-1562-004chr2:
27170503-27170503
GAUTR3De novo--Yuen2017 G
DPYSL5     465-09-112072chr2:
27164777-27164777
CGintronicDe novo--Satterstrom2020 E
DPYSL5     1-0150-003chr2:
27157805-27157805
AAAGTATAAGAGTGAAGAGCACATATintronicDe novo--Yuen2017 G
DPYSL5     2-0304-003chr2:
27103263-27103263
GGTintronicDe novo--Yuen2017 G
DPYSL5     AU04203chr2:
27164818-27164818
GAexonicDe novononsynonymous SNVNM_001253723
NM_001253724
NM_020134
c.G1090A
c.G1090A
c.G1090A
p.V364I
p.V364I
p.V364I
15.91-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
DPYSL5     7-0077-003chr2:
27165747-27165747
CAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More