or
or
Exact

Results for "BCL11A"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BCL11A     3-0018-000chr2:
60694221-60694221
GAintronicDe novo--Yuen2017 G
BCL11A     AU007503chr2:
60972232-60972232
CAintergenicDe novo--Yuen2017 G
BCL11A     AU4327303chr2:
60844278-60844278
GCintergenicDe novo--Yuen2017 G
BCL11A     AU4327303chr2:
60849068-60849068
GAintergenicDe novo--Yuen2017 G
BCL11A     2-1314-003chr2:
60771544-60771544
TCintronicDe novo--Yuen2016 G
BCL11A     AU4327303chr2:
60861081-60861081
GAintergenicDe novo--Yuen2017 G
BCL11A     2-0145-004chr2:
60700186-60700186
GGTACGTGTGTGTGTGTTTGCAintronicDe novo--Yuen2017 G
BCL11A     AU4024303chr2:
60762880-60762880
CGintronicDe novo--Yuen2017 G
BCL11A     AU4327303chr2:
60862847-60862847
GAintergenicDe novo--Yuen2017 G
BCL11A     DEASD_0096_001chr2:
60688721-60688722
GAGexonicDe novoframeshift deletionNM_018014
NM_022893
c.1325delT
c.1325delT
p.L442fs
p.L442fs
--DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
BCL11A     13183.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_018014
NM_022893
NM_018014
NM_022893
c.792dupC
c.792dupC
c.793dupC
c.793dupC
p.L265fs
p.L265fs
p.L265fs
p.L265fs
-2.0E-4Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2014 T
Satterstrom2020 E
Willsey2013 E
BCL11A     AU4159302chr2:
60881910-60881910
GCintergenicDe novo--Yuen2017 G
BCL11A     74-0075chr2:
60972232-60972232
CAintergenicDe novo--Michaelson2012 G
BCL11A     2-0214-003chr2:
60898201-60898201
TCintergenicDe novo--Yuen2017 G
BCL11A     2-1153-003chr2:
60891121-60891121
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
BCL11A     2-1430-003chr2:
60758906-60758906
CTintronicDe novo--Yuen2017 G
BCL11A     1-0346-004chr2:
60874831-60874831
TCintergenicDe novo--Yuen2017 G
BCL11A     2-1402-003chr2:
60781553-60781555
TGGTGupstreamDe novo--Yuen2017 G
BCL11A     AU3175302chr2:
60836837-60836837
GAintergenicDe novo--Yuen2017 G
BCL11A     AU4159301chr2:
60939132-60939132
AGintergenicDe novo--Yuen2017 G
BCL11A     2-1425-003chr2:
60851206-60851206
TCintergenicDe novo--Yuen2017 G
BCL11A     2-1378-003chr2:
60849571-60849571
CGintergenicDe novo--Yuen2017 G
BCL11A     AU3712302chr2:
60839970-60839970
GTintergenicDe novo--Yuen2017 G
BCL11A     1-0555-003chr2:
60909180-60909181
TGTintergenicDe novo--Yuen2017 G
BCL11A     2-1425-004chr2:
60807686-60807686
CGintergenicDe novo--Yuen2017 G
BCL11A     EGAN00001100922chr2:
60688588-60688588
CAexonicDe novostopgainNM_018014
NM_022893
c.G1459T
c.G1459T
p.E487X
p.E487X
36.0-Satterstrom2020 E
BCL11A     1-0935-003chr2:
60880788-60880788
CAintergenicDe novo--Yuen2017 G
BCL11A     2-0129-004chr2:
60905894-60905894
CTintergenicDe novo--Yuen2017 G
BCL11A     AU3905302chr2:
60962574-60962574
CGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More