or
or
Exact

Results for "MROH7"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MROH7     12792.p1chr1:
55167767-55167767
GAexonicDe novononsynonymous SNVNM_001291332
NM_001039464
c.G1844A
c.G3290A
p.R615Q
p.R1097Q
18.329.317E-6Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
MROH7     1360JS0006chr1:
55161082-55161082
CTexonicDe novosynonymous SNVNM_001291332
NM_001039464
c.C1437T
c.C2883T
p.C479C
p.C961C
-2.0E-4DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
MROH7     11354.p1chr1:
55118710-55118710
CTexonicDe novosynonymous SNVNM_001039464c.C111Tp.P37P--Krumm2015 E
Satterstrom2020 E
MROH7     iHART2528chr1:
55136565-55136587
TGCAGGAGAAGGACGAGGCCAAGTexonicPaternalframeshift deletionNM_001291332
NM_001039464
c.117_138del
c.1563_1584del
p.M39fs
p.M521fs
--Ruzzo2019 G
MROH7     iHART2303chr1:
55118705-55118705
CTexonicMaternalstopgainNM_001039464c.C106Tp.Q36X23.68.289E-6Ruzzo2019 G
MROH7     SSC02558chr1:
55118710-55118710
CTexonicDe novosynonymous SNVNM_001039464c.C111Tp.P37P--Lim2017 E
MROH7     iHART3090chr1:
55167762-55167762
GCsplicingMaternalsplicing15.28.57E-5Ruzzo2019 G
MROH7     iHART2305chr1:
55118705-55118705
CTexonicMaternalstopgainNM_001039464c.C106Tp.Q36X23.68.289E-6Ruzzo2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More