or
or
Exact

Results for "HSPG2"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HSPG2     2-1451-003chr1:
22181309-22181309
TCintronicDe novo--Yuen2017 G
HSPG2     NDAR_INVWK012EYC_wes1chr1:
22174444-22174444
CTintronicDe novo8.56-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
HSPG2     2-0244-004chr1:
22259478-22259478
GAintronicDe novo--Yuen2017 G
HSPG2     12385.p1chr1:
22181274-22181279
GGGTCAGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
HSPG2     11442.p1chr1:
22199230-22199230
GTexonicDe novostopgainNM_001291860
NM_005529
c.C3915A
c.C3912A
p.C1305X
p.C1304X
42.0-Ji2016 E
Krumm2015 E
HSPG2     F10267-1chr1:
22215188-22215188
CGintronicDe novo--Satterstrom2020 E
HSPG2     iHART2872chr1:
22207221-22207221
GCexonicMaternalstopgainNM_001291860
NM_005529
c.C1929G
c.C1926G
p.Y643X
p.Y642X
22.1-Ruzzo2019 G
HSPG2     AU1725302chr1:
22163866-22163866
CGintronicDe novo--Yuen2017 G
HSPG2     AU1860302chr1:
22275220-22275220
CTintergenicDe novo--Yuen2017 G
HSPG2     iHART3119chr1:
22178283-22178283
CTsplicingPaternalsplicing22.2-Ruzzo2019 G
HSPG2     AU1448301chr1:
22268235-22268237
CCCCCCTGTGACCAATTATATCCCCTGTGACCintergenicDe novo--Yuen2017 G
HSPG2     iHART2873chr1:
22207221-22207221
GCexonicMaternalstopgainNM_001291860
NM_005529
c.C1929G
c.C1926G
p.Y643X
p.Y642X
22.1-Ruzzo2019 G
HSPG2     iHART3115chr1:
22202171-22202171
CAexonicDe novononsynonymous SNVNM_001291860
NM_005529
c.G3256T
c.G3253T
p.D1086Y
p.D1085Y
11.12-Ruzzo2019 G
HSPG2     SSC00193chr1:
22199230-22199230
GTexonicDe novostopgainNM_001291860
NM_005529
c.C3915A
c.C3912A
p.C1305X
p.C1304X
42.0-Lim2017 E
HSPG2     12763.p1chr1:
22263991-22263991
CGupstreamDe novo--Wilfert2021 G
HSPG2     11089.p1chr1:
22162442-22162442
AGintronicDe novo--Turner2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More